1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gladu [14]
4 years ago
13

The surface area of a sphere can be approximated as follows: Surface area = 4πr2; where r is the radius of the sphere; π is a co

nstant that is roughly equal to 3. Using the simple approximation above, calculate the surface area of a sphere with a radius of 5 meters.
Biology
1 answer:
MAXImum [283]4 years ago
3 0

In apex it's "300m2"

You might be interested in
Explain why the process of mitosis is important to you eukaryotic <br> organisms
vichka [17]

The eukaryotic organisms have the process of mitosis but differently than the process of the prokaryotic because the prokaryotic organisms dont have the dna enclosed in a nucleus. Mitosis needs to occur in eukaryotic organims because the cell could keep growing an it is going to be less efficient in moving material across the cell membrane. They reason why mitosis happens is because volume and surface are do not increase at the same rate.

Explanation:

5 0
3 years ago
How does the setting of tkam contribute to the perpetuation of stereotypes?
padilas [110]
To Kill a Mockingbird, I believe is set in Alabama in around the 1960s. This was when racism was very prevalent in society. Stereotypes were made because racism was a normal thing for them. 
5 0
4 years ago
How does each new cell formed by cell division differ from the mature cell?
Natasha_Volkova [10]
C . Each new cell has different information in its nucleus
7 0
2 years ago
TRUE OR FALSE?
Harrizon [31]
<h2>Answer:</h2>

I believe the correct answer is FALSE.

<h2>Explanation:</h2>

Innate immunity is a fast acting response to confront a pathogen but does not keep memory. It is initiated and carried out by cell and can be refered to as cellular immunity lasting for a short term.

<h2>Further Explanation:</h2><h3>Innate Immunity:</h3>

This is the first line of defence and involves only cells. It lasts for a short period usually around 12 hours. It includes physical barries. The cells involved are: epithelial cells, dendritic cells, plasma proteins and natural killer cells. All the cells involved are macrocytes. It functions to recognize and attack the pathogen before the second type of immunity called adaptive immunity sets in. It usually is also non specific and responds generally to any pathogen.

<h3>Adaptive Immunity:</h3>

It is a much more longer lasting type of immunities and has memory. It has a combination of cells and humoral components. It involves Naive B cells which are triggered to release antibodies known as Immunoglobulins depending on the cause of the trigger. Immunoglobulins include IgG, IgM, IgA, IgG  and IgD and are usually Y-shaped. Additionally, it involves Naive  T cells that are activated into Effector T-cells to assist in fighting the pathogen. This type of immunity is more focused and specific antibodies are released for specific infections/pathogens. It lasts up to 5 days or longer depending on the pathogen. It also takes time to mount up and produce a response.

Level: High School

3 0
3 years ago
If 2n=8 how many chromosomes do the organism's gametes contain
fenix001 [56]
4 i guess........................
5 0
4 years ago
Other questions:
  • List plant or animal organelle more then 3 please thanks :)
    9·1 answer
  • 1. The sun's energy is classified by the
    14·2 answers
  • Liquid, fresh water percentage
    5·2 answers
  • 1. Carrying capacity is the maximum number of ____ that an ecosystem can support. A. Different species B. Individuals in a popul
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • what is living being ?write difference between plants and animal. write any 3 characteristics of the animal that live in water .
    14·1 answer
  • You are interested in mapping the location of two loci in crested geckos that control different aspects of the crest phenotype.
    14·2 answers
  • What is the relationship between convection currents, seafloor spreading, and the formation of ocean basins?
    11·2 answers
  • Questions are in the attachments I’ll give a brainlist
    8·1 answer
  • What is the answer of the question?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!