1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artist 52 [7]
3 years ago
5

What will happen to an ecosystem that is experiencing a prolonged drought?

Biology
2 answers:
Harlamova29_29 [7]3 years ago
8 0

If an ecosystem was experiencing a prolonged drought, there would be a big decrease in the population. All living creatures require water, even the ones well adapted to little water. There probably would be as many planets, for the ones surviving would be ones managing to get water, or ones that can survive off little water. Now on the other hand the animals then wouldn't be getting enough food or water, so then again ones who would manage to survive would be ones adapted to little water and food or are excellent hunters.

  You can also expect some animals to leave the ecosystem look for a better source of water and food.

hope this helps to some degree

Akimi4 [234]3 years ago
4 0

Answer:Either all or almost all animals will die and maybe go extinct and the plants will do the same

Explanation:that’s bc animals need water to survive without it they die and the plants also need water so they’ll die to

You might be interested in
"Scientists will often grow bacteria in prepared petri dishes. In some experiments, the petri dish will also contain paper disks
emmasim [6.3K]
I think you forgot to post the picture needed for the question. However, after some research I found it online. The picture should show a circle with areas for bacteria growth, area of no growth (ZOI) , and antibiotic disc A. The diameter in mm of the ZOI for disk A will be 13 mm. 
6 0
3 years ago
How many muscles are in a human body?
djyliett [7]
There are 640 muscles......
3 0
3 years ago
2. If nearly 79% of the atmosphere is made of nitrogen, how could there be a shortage of nitrogen in soil?
Margaret [11]
Nitrogen must be converted into nitrates before organisms can use it. If soil lacks nitrogen fixing bacteria, then it has few nitrates for the plants to take in.
3 0
3 years ago
What is a rock I need to know this fast
anyanavicka [17]
A mixture of minerals that makes up the earths crust.
8 0
4 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Other questions:
  • what types of enzymes are used to cut strands of dna into pieces before placing the dna in a gel for gel electrophoresis
    15·1 answer
  • After visiting a nature center, students were asked to contrast their observations based on location. Which of these students fo
    12·2 answers
  • Daniela and Alicia are conducting a systematic observation study on children's aggressive behavior in the playground. Daniela co
    7·1 answer
  • Which has a rock type the most sparkles in it?
    8·1 answer
  • Trace the energy path from the sun to our cells
    14·2 answers
  • A student is hold a snowball in her hand.Which photo shows the direction of thermal energy transfer?
    11·2 answers
  • Why might patients who go into remission get a different type of cancer?​
    9·1 answer
  • 40 POINTS
    14·1 answer
  • Analyzing which form of data provides the most detailed information for classifying
    12·1 answer
  • can someone explain what the mitochondria does to APT and how it produces energy, I need it for my notes.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!