1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tresset_1 [31]
2 years ago
14

What is the most common type of vegetation in southwest and central asia

Geography
1 answer:
Eduardwww [97]2 years ago
8 0

Answer:

Desert Scrub.

Explanation:

Desert Scrub normally refers to a desert biome. However, it can also be used to describe several types of plants that grow on these habitats, such as the creosote bush or the rabbitbrush, and others.

These types of plants are capable of withstanding environments with very little precipitation like the southwest and central regions of Asia, which is mostly covered by great extensions of desert biome.

You might be interested in
HELP ME PLEASE<br>Main sequence stage occurs as a star burns through what?
padilas [110]

Main sequence stars burn through hydrogen

5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Sustainable development of resources?<br>​
Oxana [17]
Natural resources made people be able to live their life and it all had to do with their geography
5 0
3 years ago
Read 2 more answers
60°N
nirvana33 [79]

Answer:

Arithmetic Density

Explanation:

it is the total number of people divided by the total land area and this is just talking about population density not the amount of arable land (physiological density) or comparing the number of farmers to the area of arable land (agricultural density)

7 0
2 years ago
Look at the bar graph, then select the best answers
11Alexandr11 [23.1K]

Answer:

1. 19,014

2. 2012

3. Less

Hope it helps!

7 0
2 years ago
Other questions:
  • Southwestern north america contains a large area called the basin and range province. what is the origin of this name?
    7·1 answer
  • The two requirements for a strong planetary magnetic field are rapid rotation and a convective interior zone composed of an elec
    5·1 answer
  • Monsoons are most likely to occur in which of these months?
    7·1 answer
  • If you picked up a basalt rock which was shaped like a teardrop it could be a
    9·1 answer
  • How many people live in Mexico City?
    15·1 answer
  • Which barrier to economic development is shown in the following examples?
    5·2 answers
  • Explain the formation of coal or oil and natural gas​
    7·1 answer
  • What are 3 effects of a hurricane on an ecosystem
    6·1 answer
  • What is the name of the supercontinent 200 million years ago that fragmented into our present-day continents? A. Pandora B. Pang
    14·2 answers
  • Reverse faults are created when plates push ________ each other.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!