1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
3 years ago
13

What’s the change in thermal energy and particle arrangement of molten steel after becoming completely solid

Biology
1 answer:
Ann [662]3 years ago
6 0

<u>Change in thermal energy and particle arrangement of molten steel after becoming completely solid:</u>

Due to the rise in the temperature, the particles start moving speedily. Because of the achieving the kinetic energy, which helps in the higher collision rate and makes the diffusion rate high. In case of the solids the particles are strongly bound in sequential order. Even though we can’t see it, but the vibrations can be felt. During heating the internal energy increases and helps the particle to move faster.  

You might be interested in
In a diploid invertebrate, genes d and e are closely linked. single crossovers between these two genes occur only in one out of
Kryger [21]
Mircosope transfer to cells
8 0
3 years ago
Explain what is meant by the term environmental justice.Explain why land use planning has to incorporate such diverse discipline
madreJ [45]

Answer:

Land use planning is about more than addressing the physical layout of development, how much it will cost, where it will be located and aesthetics. Land use planning also incorporates environmental impacts such as chemical pollution, noise pollution, flooding due to the loss of trees and plants, etc. In order to meet all these requirements land use planning must draw from a wide array of disciplines' expertise.

Explanation:

mark me brainliest plsssss

3 0
3 years ago
Which sections of DNA are used in DNA fingerprinting?
hammer [34]
DNA fingerprinting is where DNA is used to create a profile for someone often in crimes. The STR or Short Tandem Repeats are used for this. STRs are non-coding sections of DNA which repeat themselves for example CACACACACACACACACACA the location of this STR and the length of the STR (how many times it repeats) are used to identify a specific person
7 0
3 years ago
Read 2 more answers
An etiologist is investigating a new disease and observes what appear to be bacteria inside tissue cells in clinical samples fro
Arturiano [62]

Answer:

Explained

Explanation:

The first thing that the etiologist can do is try and culture bacteria from the tissue samples in the lab. And then study about the bacterium's properties and characterstics that are leading to causing diseases in the humans.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Vitamin D precursors are produced in the skin in the presence of sunlight. These chemicals are important for the transport of so
    11·1 answer
  • 22. Which of the following is not a component of the pancreatic juice?
    7·1 answer
  • Many poisonous mushrooms are extremely colorful. One hypothesis is that the colors serve as a warning to prevent animals from ea
    10·2 answers
  • Enzymes can increase the rates of reactions over a miltion fold but they do not accomplish this by
    15·1 answer
  • actual question! lol. . Animals marking their territory with urine is an example of _______.. a.. competition. b.. predation. c.
    14·2 answers
  • A small glitch in a DNA sequence is called a
    13·2 answers
  • Ribosomes are the site where __ is produced ?
    9·1 answer
  • Two main functions of leaves are photosynthesis and____.
    10·1 answer
  • If the organisms at level 2 were to decrease, explain what would happen to 6 points
    15·1 answer
  • What are 4 characteristics of metals?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!