1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olegator [25]
3 years ago
12

Andrew wants to determine if playing classical music will affect the growth of his rose bushes. Determine the independent variab

le of this experiment.

Biology
1 answer:
DIA [1.3K]3 years ago
6 0

Answer:

playing or not playing classic music to the rose bushes

Explanation:

independent variable is the variable the expirementer changes or controls.

You might be interested in
What happens to animals that are deprived of oxygen
7nadin3 [17]
When animals are deprived of oxygen they die. 

Explanation;
Oxygen is an important gas in any animal's life. Animals need it to survive. 
Oxygen is required mainly for the process of cellular respiration, a process which plants use to generate energy that is required by the cells to carry out basic functions such as growth and movement. Without these basic  functions animals can not survive. Therefore; when animals are deprived of oxygen, they may utilize nutrients through anaerobic (without oxygen) respiration, after which they will eventually die. 
5 0
3 years ago
Read 2 more answers
Most colonies on streak plates grow from isolated colony-forming units. on rare occasions, however, a colony can be a mixture of
umka2103 [35]

<span>To verify the purity of a colony, a number of steps could be adopted. Pick the colony and dissolve it in sterile water (approximately 5ml), streak in media again and incubate. Observe if it produces pure colonies of the chosen organisms and if not, repeat the procedure until pure colonies are produced. Additionally, one could perform additional tests that categorize bacteria such as Gram staining.   </span>


7 0
3 years ago
Read 2 more answers
Why is gene regulation necessary for multicellular organisms
kozerog [31]
<span>as you need to produce different phenotypes from the same genotype you need to regulate gene expression (turn some on, others off).</span>
7 0
3 years ago
Whats the carrying capacity?
r-ruslan [8.4K]

Answer:

2003-25

Explanation:

To find carrying capacity on a graph, you need to locate the point on the graph where the population line is horizontal. Alternatively, the carrying capacity may be explicitly marked with a dotted horizontal line or a horizontal line of a different color.

7 0
3 years ago
C6H12O6 is a type of..<br><br> A. amino acid<br> B. carbohydrate<br> C. polymer<br> D. protien
Nataly [62]
B. carbohydrate
C6H12O6 is the formula for sugar, and sugar is a carbohydrate.
7 0
3 years ago
Read 2 more answers
Other questions:
  • What is A gas that is released into the air and soil during the process of breathing and decomposition
    12·1 answer
  • during the race the body temperature of a runner increases. The runner body responds by perspiring (sweating), which lowers the
    6·2 answers
  • The information specifying the traits of an organism is present in units of chemical substances in the center of a DNA molecule.
    6·1 answer
  • What are the consequences of abundant populations of feral pig
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Plants respond to changes in their environment. The growth of a plant in response to a stimulus is called a(n)
    9·2 answers
  • How can you measure the volume of an object if it is not shaped like a box? 
    8·2 answers
  • Define and describe marine ecosystem!
    7·1 answer
  • The study of structure or how organisms are organized on the cellular, tissue, organ, system, or organism levels is called what
    5·1 answer
  • How did the Avery experiment expand on Frederick Griffith's observations?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!