1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
9

99 POINTS

Biology
2 answers:
Oksanka [162]3 years ago
5 0
I think it would be 34.4 ml
dybincka [34]3 years ago
5 0

The correct answer would be 34.4 ml

You might be interested in
One unique characteristic distinguishing animals from members of other kingdoms is animals A. include both aquatic and terrestri
Bogdan [553]
A. include both aquatic and terrestrial species.

4 0
3 years ago
Read 2 more answers
3. The cell wall is compared to what job?
Korolek [52]

Answer: The cell wall surrounds the plasma membrane of plant cells and provides tensile strength and protection against mechanical and osmotic stress.

3 0
4 years ago
Read 2 more answers
From what fish does beluga, osetra, and sevruga come from ?
spin [16.1K]
These are sources of very good cavier. The beluga is actually a whale, while the osetra is a sturgeon. The sevruga is also a sturgeon.
8 0
3 years ago
Hormones can alter the amount of water reabsorbed during urine production, allowing the production of either concentrated or dil
Sedaia [141]

The amount of water reabsorbed during the formation of urine can be changed by hormones, enabling the creation of either concentrated or diluted urine. The duct serves this purpose.

In heating, ventilation, and air conditioning (HVAC), air is delivered and removed by ducts, which are conduits or passageways. Examples of the necessary airflows include supply air, return air, and exhaust air.  As part of the supply air, ducts frequently deliver ventilation air as well. As a result, air ducts are one way to guarantee both thermal comfort and adequate interior air quality. The brain releases a substance called antidiuretic hormone (ADH), which makes the kidneys release less water and reduces the volume of urine generated. The body makes less pee when its ADH level is high. A low

Learn more about The duct here.

brainly.com/question/28209437

#SPJ4

3 0
2 years ago
There is the picture to the question
skad [1K]

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

6 0
3 years ago
Other questions:
  • Most precipitation forms in clouds high up in the atmosphere. Why is this the case?
    8·2 answers
  • List the steps of dna replication in order
    15·2 answers
  • What do we call a molecule that has a ratio of two hydrogen atoms for every one atom of carbon and oxygen?
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Question 2
    14·1 answer
  • based on the chart approximately how much of the planets water is available to human beings for household, agricultural, and ind
    7·1 answer
  • Some engineers are creating models of several unicellular organisms. What would all the models have in common?
    15·1 answer
  • One scientific principle involved in soap production<br>​
    11·1 answer
  • Pls help again, brainlist!!!!!!!!!!!!!!!!!
    11·1 answer
  • Characterization of the leptospiral outer membrane and description of three novel leptospiral membrane proteins
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!