1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
9

A cell is a complex assembly of _____ working parts.

Biology
2 answers:
taurus [48]3 years ago
7 0
I believe the answer is interactive.
alexgriva [62]3 years ago
7 0

Answer:

A cell is a complex assembly of interrelated working parts.

Explanation:

Cells can be defined as the structural and functional units of all living things. These structures are alive, carry the genetic information of a particular organism and are capable of transmitting this information at the moment of cell division. A cell is made up of some basic parts that work together for cell function. In short, we can say that a cell is a complex set of interrelated workpieces.

We usually say that all cells have a plasma membrane, cytoplasm, and nucleus. However, there are cells that do not have this last structure, which is even a way to differentiate two types of cells: prokaryotes and eukaryotes.

You might be interested in
Dr. Fatima was investigating the pathways in photosynthesis. She observed a set of chemical reactions whereby electrons were get
Anastasy [175]
The answer would b a so the top person is correct:))
4 0
3 years ago
Why is the air colder farther from the earth?
Mandarinka [93]

Answer:

Why is the air colder farther from the earth,you ask ?its easy

Explanation:

A pretty basic answer is that the farther away you get from the earth, the thinner and thinner  the atmosphere gets. The total heat content of a system is directly related to the amount of matter present, so it gets cooler and cooler at higher elevations.

5 0
3 years ago
how could scientists test the hypothesis of different areas having lighter or dark skin pigmentation ​
Sergeu [11.5K]

scientists can test differences of the area with pigmentation by observing which is lighter and which is darker however they use microscope to look the difference of the pigmentation over the cells.

4 0
3 years ago
Describe all 3 forms of rna and discuss their function?
Vanyuwa [196]

There are 4 types of RNA, each encoded by its own type of gene. ... mRNA - Messenger RNA: Encodes amino acid sequence of a polypeptide. tRNA - Transfer RNA: Brings amino acids to ribosomes during translation. rRNA - Ribosomal RNA: With ribosomal proteins, makes up the ribosomes, the organelles that translate the mRNA.


5 0
3 years ago
What would a driptorch be used for?
anyanavicka [17]

Answer:

bbbbbbbbbbbb;bbbbbbľ:"'ć

8 0
3 years ago
Other questions:
  • Cells transplanted from the neural tube of a frog embryo to the ventral part of another embryo develop into nervous system tissu
    11·1 answer
  • When members of the same species live in the same place, they form a(n) ?
    12·1 answer
  • I need help on sun review answer key.
    9·1 answer
  • Would you describe yourself as belonging to a specialist species or generalist species? Give reasons for your choice
    14·2 answers
  • The most complicated part of the brain is the
    6·2 answers
  • In the cell, enhancer sequence functions are limited in their range of action by the formation of ___________ that hold specific
    13·1 answer
  • What kind of organism developed first​
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • For which reasons would a male peacock spread his tail feathers?
    11·1 answer
  • Describe three differences in the organelles of plant and animal cells.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!