1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesantik [10]
2 years ago
5

What macromolecule is produced during translation?

Biology
2 answers:
mash [69]2 years ago
6 0
The macromolecule is known as protein when produced from the process of translation
podryga [215]2 years ago
3 0
The correct answer would be D.Protein
You might be interested in
Which is the correct sequence of events during embryonic development?
Sloan [31]
The answer is A. cleavage, differentiation, fertilization, gastralution

6 0
2 years ago
Read 2 more answers
Choose the arrangement that lists the chemicals in the order in which they would be used for coagulation.
NARA [144]

Answer:

Option A

Explanation:

Please see the attachment

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
How many amino acids are found and in living organisms
posledela
<span> All the millions of different proteins in living things are formed by the bonding of only </span>20 amino acids<span> to make up long polymer chains.</span>
4 0
3 years ago
Read 2 more answers
Help with this for science homeworK!!!
pantera1 [17]
If you look at this what do you see the earth and when there is the full moon what do you see. 

7 0
3 years ago
Read 2 more answers
Other questions:
  • How do I do this? plz help its biology. download the pdf and open it up plz thx
    14·2 answers
  • I can't figure out the answer
    14·1 answer
  • Can I Have Some Help
    13·2 answers
  • Distinguish between wilting and desplasymolysis​
    5·1 answer
  • Which of the following units of measure should be used to measure the length of an automobile?
    5·1 answer
  • A researcher is studying two different populations of dolphins that live in two different oceans. You read the research paper, a
    14·2 answers
  • Fossils provide evidence for all of the following EXCEPT for
    13·2 answers
  • The earth is considered to be in the Goldilocks zone.why?
    15·1 answer
  • How do I know that diagram of amoeba cell division is Asexual reproduction in an amoeba
    8·1 answer
  • At which state of respiration does the co2 release that place
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!