1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
6

A : a fertilized egg

Biology
1 answer:
UNO [17]3 years ago
3 0

Answer:

blastocyst means

C : a mass of specialized eggs

it helps in the development of cells in the egg.

You might be interested in
What are 2 ways fingerprinting is used.
kogti [31]

Answer:

1. to get into certain types of iphones

2. at Disney world they have you scan your finger to get into the park

Explanation:

8 0
3 years ago
Read 2 more answers
Which do all cells need in order to function?<br> oxygen<br> watercarbon dioxide<br> offspring?
zaharov [31]

Answer:

oxygen for animals

plants cells need water and CO2

6 0
3 years ago
How does the structure of the knee joint allow for jumping and landing?
S_A_V [24]

Answer:

Activities such as running and jumping require the quadriceps to generate large knee extension forces. The force generated from these muscles pulls strongly on the tibial tuberosity via the patellar tendon.

Explanation: hope this helps

8 0
2 years ago
Vitamins are nutrients that are not made by living things. true or false
GrogVix [38]
True, as to why your doctor recommends you to eat more vegetables or go outside among other things to get more vitamins and stay healthy.
7 0
3 years ago
Help greatly appreciated!
Georgia [21]

Answer:

the answer is two times

Explanation:

If brainiest is earned its greatly Appreciated

4 0
3 years ago
Other questions:
  • Mr. Jones is an 85-year-old male who has gross hematuria, likely from a prostatic source. He has had a turp in the past. What is
    13·1 answer
  • Some major secretory molecules of the prostate are:
    7·1 answer
  • What would happen without any decomposers in the cycle​
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is a instructive igneous rock
    10·1 answer
  • Which macromolecule are not considered polymers
    8·1 answer
  • Most atp in cellular respiration is regenerated in substrate level phosphorylation. most atp in cellular respiration is regenera
    13·1 answer
  • Is unicellular eukaryotic or prokaryotic
    12·2 answers
  • Which of these is a pure substance? a. diamond b. salt c. ocean water a only a, b, and c a and b b and c
    5·1 answer
  • What amino acid would be used if the DNA codon was GTT
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!