1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
8

27. In 1986, a meltdown of a nuclear reactor in the city of Chernobyl, in Ukraine, released highly radioactive chemicals into th

e atmosphere. As a result, people suffered various forms of cancer because of exposure to these radioactive chemicals. Cancerous cells divide much more often than noncancerous cells and form tumors in the body.
(A) The radioactive chemicals burned people’s skin, which increased cell division rates in the people who developed cancer.


(B)The radioactive chemicals polluted people’s food, which changed some people’s ability to digest proteins and caused cancer.


(C) The radioactive chemicals caused structural changes in people’s genes, which changed how proteins functioned in cell division.


(D) The radioactive chemicals polluted people’s drinking water, which caused cells to divide more quickly in the people’s bodies and form tumors.
Biology
1 answer:
Dafna1 [17]3 years ago
6 0

Answer:

I believe the answer could be B

You might be interested in
The language of genetics answer sheet
Margaret [11]
From what class exactly? 
8 0
3 years ago
Explain how gravity keeps planets in orbit around the Sun.
MaRussiya [10]
It pulls towards it until it gets to a certain point and pushes away and so it stays in a steady orbit
3 0
3 years ago
After watching the video, how would you define the term ecological relationship? Are they always beneficial to organisms involve
dangina [55]

Answer:

There is no video but ecological relationship will be defined on a general note and it is not always beneficial to organisms.

Explanation:

In an ecosystem, organisms of the same or different species tend to interact with one another. This interaction is referred to as ECOLOGICAL RELATIONSHIP between the involved organisms. An ecological relationship can be of different types depending on the effect.

SYMBIOSIS is an ecological relationship between two organisms that interact together. SYMBIOSIS can either be mutualistic (both organisms benefit), parasitic (one organism loses and one gains), or commensalistic (one organism benefits and one neither benefits or loses). Another ecological relationship is PREDATION, where one organism called the PREDATOR feeds on part or all of another organism called PREY in order to obtain energy.

As stated above, some of the organisms involved in an ecological relationship benefits while others lose. Hence, it is not always a beneficial relationship to organisms.

7 0
3 years ago
The largest component of the neuron, which coordinates the information-processing tasks and keeps the cell alive, is the: axon.
mylen [45]
The answer to that question is Cell Body
8 0
3 years ago
Differences in air pressure drive the global wind systems on earth. Which term describes polar winds that blow from east to west
Darya [45]
Trade winds (D) is the answer
6 0
3 years ago
Other questions:
  • The nursing student has just reviewed material in the course textbook regarding pancreatitis. The student knows that a major sym
    5·1 answer
  • How should molecular clocks be used if not all mutations occur at the same rate?
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What happens when gas and dust in the solar system moves closer together?
    9·2 answers
  • Drug abuse is defined as __________. A.the consumption of legal drugs for medical purposesB.the consumption of illegal drugs for
    12·1 answer
  • 3) Are greenhouse gases beneficial? Harmful? Explain your answer.
    5·2 answers
  • PLEASE HELP!! ASAP.
    15·1 answer
  • What is the S.I unit of speed , time​
    5·2 answers
  • The direction of force of Earth's magnetic field is from the geographic South
    7·2 answers
  • Who is hotter Tom Hiddleston or Sebastian Stan??
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!