1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allushta [10]
3 years ago
10

If a radioactive isotope undergoes alpha decay it’s mass number changes by ?

Biology
1 answer:
Elis [28]3 years ago
7 0

-4

Explanation:

If a radioactive isotope undergoes alpha decay, it's mass number will change by -4.

The mass number of a nuclei is the sum of its number of protons and neutrons.

An alpha particle is similar of a helium atom:

            ⁴₂He

The atom above is made up of:

  mass number = 4

  Atomic number = 2

  Number of protons = 2

  Number of neutrons = 2

 Number of electrons = 2

If a substance is undergoing radioactive decay, the mass number of the product will decrease by 4 and the atomic number will decrease by 2.

In nuclear equations, mass and atomic numbers are usually conserved.

learn more:

Transmutation brainly.com/question/3433940

#learnwithBrainly

You might be interested in
What is a good sentence for the word absolute dating
blsea [12.9K]
Absolute gonna get married fu. ck have children realize why the fu. ck did you do this and die at 95.

I blame charlie scene
8 0
3 years ago
In the sporophyte plants produce ________________________?
matrenka [14]

Answer:

spores

Explanation:

plant body grows and eventually produce spores through meiosis.These spores divide mitotically to produce haploid (having a single set of chromosomes)

4 0
3 years ago
Which is the term for a hormone that acts on the same cell that secreted it? A : limited hormone B : paracrine C : autocrine D :
suter [353]

Answer:

C: autocrine

Explanation:

There are three types of hormones according to where their target cells are.

  • Endocrine: Their target cells are distributed far and they travel via blood to reach the target cells.
  • Paracrine: Their target cells are often their neighbors so they often diffuse to reach them
  • Autocrine: Their secretion acts on themselves. Hence they are their own targets.  
3 0
3 years ago
Which factor most strongly influences the kinds of plants that can grow in an
Illusion [34]

B. The area's climate

Specific plants need specific climate conditions in order to survive. The other answer choices have little to no impact on the growth of plants.

8 0
4 years ago
The energy that powers photosynthesis comes from
Rudik [331]
That Energy comes from SUNLIGHT.....
7 0
3 years ago
Other questions:
  • How are genes and nitrogen bases related?
    6·1 answer
  • is it possible for technological advancements to have both positive and negative effects on the world
    15·1 answer
  • Numerous fossils are currently forming in the deserts, forests, polar regions, and under the oceans.
    6·1 answer
  • which of the following statements about earthquake is false? A. Surface wave travel more slowly than either P- or S-waves. B. S-
    8·1 answer
  • Sid wants to end his habit of smoking three packs of cigarettes a day; ted wants to stop his serious drinking problem. which tre
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is a disadvantage of the point count of monitoring of population monitoring
    13·1 answer
  • When you get a cold, which of the following does your body make more of?
    5·1 answer
  • water shows (blank) bonding where electrons are shared (blank). This makes water very special and important to life
    12·1 answer
  • Reabsorption of filtered glucose from the lumen in the pct is largely by means of:______.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!