1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
8

What factors affect water quality?

Biology
1 answer:
Artemon [7]3 years ago
6 0

Many factors affect water quality

Sedimentation.

Runoff.

Erosion.

Dissolved oxygen.

pH.

Temperature.

Decayed organic materials.

Pesticides.

You might be interested in
Which characteristics is common to all three groups of reptiles?
Flura [38]

They are ectotherms.

hope it is helpful to you

7 0
3 years ago
Read 2 more answers
When a family faces a situation that is too hard to solve by itself, it is a sign of strength to _____. (1 point) ask for help n
bulgar [2K]

When a family faces a situation that is too hard to solve by itself, it is a sign of strength to ask for help.

8 0
3 years ago
Read 2 more answers
Give an example of a free-living flatworm and a parasitic flatworm
harkovskaia [24]

Free-living flat worms = carnivores or scavengers
Have digestive cavity, mouth, pharynx 

Parasitic Flatworms: = Feed on blood, tissue fluids, or pieces of cells from within a host

4 0
3 years ago
Read 2 more answers
Which best describes the main sources of energy in the United States?
Sever21 [200]

Answer:

D

Explanation:

Most of the energy in the United States comes from the burning of fossil fuels (coal, oil, natural gas). Hope this helps!

3 0
3 years ago
Read 2 more answers
Jasmine earned $150 last week.Jay earned $130 last week. they combined their money and decided to donate 1/4 of their total amou
vova2212 [387]
Last night Jasmine and Jay amount combined is $150+$130=$280
amount donated to charity is 1/4 of $280= $70
amount spent at an amusement park is` 40/100 x $210= $84
the remaining money = 280- (70+84)= $126

35% of their original amount is 35/100x$280=$98

so Jay's claim is not correct because the remaining money is $126 and not $98 as she Jay claims.
8 0
3 years ago
Other questions:
  • Which of the following produces the first heart sound?
    10·2 answers
  • What form of reproduction is shown
    10·1 answer
  • How does sound energy travel?<br> A. in strings<br> B. in beams<br> C. in pulses<br> D. in waves
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Look at sucrose, a disaccharide, and cellulose, a polysaccharide, on the carbohydrate page. How do you think these two molecules
    10·1 answer
  • FILL IN THE BLANK.
    9·1 answer
  • ¿Cuáles son los derechos que defiende el Fondo De Las Naciones Unidas Para La Infancia?
    8·1 answer
  • Cual es la relación del ADN con el tamaño de la bacteria?
    12·1 answer
  • How fast can you answer correct..? How fast can i give you brainliest. Explain Your answer:D
    11·2 answers
  • The
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!