I would say to back away really slowly, and don't make any sudden movements, Honey Badgers are very aggressive and any sudden movement may make them feel threatened especially if you are in or near their territory.
I Hope This Helped
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Individuals with the most favorable traits survive and reproduce'
I think the absence of light will will stop the leaves from photosynthesis because light is necessary to make plant food.
Please don't copy off this answer. It is just an idea.off
If you need a better explanation just as in the comments.
Happy to help! Please mark as BRAINLIEST! Thanks
a, c, and e! good luck <3