Emergency Operations Centers (EOCs) are the National Incident Management System (NIMS) command and coordination structures that are offsite locations where staff from multiple agencies come together.
Emergency operations center (EOC) is a control facility that functions mainly for incident response. This center serves as a central intelligence arena where response team personnel and decision makers gather and analyze extremely important information, organize response activities, make decisions that guards life and property, communicates with staff and response team personnel and ensure the consistent existence and operation of the organization.
C. The associates proteins are histones
I know that there’s 40 different species of boa constrictor
Some of the morphs include albino boa, anery boa, Aztec boa, blood boa, boawoman caramel boa, eclipse boa, ghost boa, hypo boa, jungle boa, leopard boa, motley boa, paradigm boa, snow boa, snowglow boa, and sunglow boa.
Not sure if that’s the answer you’re looking for but I tried
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The answer to that question would be C. temperature
