I believe 2 in first options, and number 2 in second options
Answer: Small countries, such as Bangladesh, are practicing subsistence fishing, taking only the fish needed to survive.
Explanation:
Answer: A
Explanation: It is a mineral acid composed of the element sulfur, oxygen and hydrogen, with the formula H²SO⁴.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Reflex action is the response to a stimulus. The spinal cord along with the brain stem is responsible for the reflex movement.
For example : when you touch a hot object you immediately remove your hand from it