1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
If a patient comes into the ER with heart attack-like chest pains and has high amounts of lactic acid in their blood , what is l
TEA [102]

Answer:

it's called I guess high blood pressure

Explanation:

due to a sudden shock or heavy loads carry that weaken the human body

7 0
3 years ago
Describe the contributions of Hutton and Lyell.please explain
morpeh [17]
Hutton: created the idea that a (water erosion basically)continuing process formed and destroyed the rocks and soils of the Earth and that the process was a never ending loop. 
Hutton laid the conceptual foundation for uniformitarianism geology

Lyell: added names and ages to the different layers of rocks
Lyell built the structure of geology upon that foundation
8 0
4 years ago
Ingrid drew a diagram to compare two ways in which biodiversity can be protected.Which label belongs in the area marked Y?
Usimov [2.4K]
The answer is D because its comparing and the other will just be listing 
3 0
3 years ago
Read 2 more answers
Which part of speech is the underlined word?
mestny [16]
The answer is D. pronoun
3 0
3 years ago
Read 2 more answers
Which statement illustrates an exception to the concept that the cell is the unit of structure and function of all living things
Lana71 [14]

Answer:

I think the answer is d, as the cell possess a cell wall are non living

7 0
3 years ago
Other questions:
  • What role do plant hormones play in phototropism
    6·1 answer
  • Help! Carbon dioxide and temperature. The CO2 value in 48000 BC was 278ppm and the value in 400 BC was 285ppm. the temperature a
    5·1 answer
  • When an organism of many cells breaks up into two or more parts and these parts survive to produce a new organism, reproduction
    10·2 answers
  • Explain the importance of the surface area to volume of ratio
    13·1 answer
  • How do the processes of weathering, erosion, and deposition affect the ecoregions of Texas? Give a specific example of how each
    11·1 answer
  • In order to change C to B to A, one would need to:
    10·1 answer
  • ryan loves taco bell and frequently eats there during the week. he is not very physically active and has noticed that he has gai
    13·2 answers
  • Shelled protozoans become a part of _________________ layers
    13·1 answer
  • Explain active transport in two sentences​
    10·1 answer
  • A fire totally destroyed a forest. It will gradually undergo “succession.” What does this mean?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!