1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
A patient underwent debridement of the acromion, subacromial bursectomy, division of the coracoacromial ligament, and an abrasio
Flura [38]
831.00,  81.82, 83.5  are  the  icd-10   code  that  are  reported  to  a  patient  who  underwent dibridement  of  the  acromion, subacromial  and  abrasion  acromioplasty. Bursectomy  and  division   of  the  ligament  are  included  in  the   acromioplasty.The   dislocation  is  not  acute  but  is  stated as  recurrent.
7 0
4 years ago
Infants can see objects before they can control their torso, and they can use their hands long before they can crawl or walk. Th
Brilliant_brown [7]

Answer:

The correct answer is cephalocaudal pattern of growth.

Explanation:

Cephalocaudal signifies head to toe, the cephalocaudal pattern of growth is generally witnessed in the initial years of postnatal development, that is, from infancy to toddlerhood. The cephalocaudal development signifies the growth and development starting from the head to the parts below.  

In this pattern of growth, the infant possesses the tendency to first acquire their control over the muscles of the neck that makes them hold their head in a steady manner. The cephalocaudal pattern is the tendency of the infant to make use of their upper limbs first like hands before making use of their lower limbs, that is, for crawling or walking.  

8 0
4 years ago
What kind of waves are present during an earthquake? ...
Aleksandr [31]

Answer:

1.The two main types of waves are body waves and surface waves. Body waves can travel through the earth's inner layers, but surface waves can only move along the surface of the planet like ripples on water. Earthquakes radiate seismic energy as both body and surface waves.

2. As the combustible materials burn, some of the chemical energy is transformed into heat energy, and some is transformed into light energy. Light energy, also known as radiation or electromagnetic energy, is a type of kinetic energy that takes the form of visible light waves, such as the light from a match

3. Newton's second law of motion is F = ma, or force is equal to mass times acceleration.

4. Answer: Refraction is the bending of light (it also happens with sound, water, and other waves) as it passes from one transparent substance into another. This bending by refraction makes it possible for us to have lenses, magnifying glasses, prisms, and rainbows. Explanation: Refraction.

5. The Density Calculator uses the formula p=m/V, or density (p) is equal to mass (m) divided by volume (V). The calculator can use any two of the values to calculate the third. Density is defined as mass per unit volume.

7 0
3 years ago
A cat gives birth to kittens that do not look identical to either parent but rather look like a combination of both. however, a
ELEN [110]
Codominance and dominance of alleles
7 0
2 years ago
A student constructs a Venn diagram to compare the organelles in plant and animal cells. which should be in the "Plant only?
Airida [17]
Chloroplasts because chloroplasts
8 0
4 years ago
Other questions:
  • Discuss how a specific genetically modified organism might provide a benefit for humans and at the same time pose a threat to a
    13·1 answer
  • The gull eggs are 30,234 times more contaminated with PCBs than the phytoplankton.
    15·1 answer
  • Frog lungs are poorly developed. How does this relate to their skin being thin and moist?
    8·1 answer
  • How does the body make use of amino acids from proteins?
    5·1 answer
  • In giraffes, long necks (N), long legs (L), dark spots (D), and the ability to digest meat (M) are all dominant traits. What pos
    11·1 answer
  • What does comparing the weight if a mineral to an equal volume of water tell you?
    8·1 answer
  • Difference between setae and chaetae
    7·2 answers
  • How are plant and animal cells similar?
    8·2 answers
  • Which of these modes of transmission require a bodily opening either natural or artificial?
    10·1 answer
  • PLEASE HELP ILL GIVE BRAINLIEST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!