2 years ago

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology

1 answer:

torisob [31]2 years ago

5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in

Original DNA sequence: T A C G C G T G C A C G A T G C A G T A G T A C mRNA sequence:

Black_prince [1.1K]

Answer:A U G C G C A C G U G C U A C G U C A U C A U G

Explanation:

4 0

3 years ago

High blood pressure

kirill115 [55]

Answer: b. can lead to other cardiovascular diseases

Explanation:

High blood pressure or hypertention can be define as a condition in which the flowing blood exerts force over the walls of the arteries. The arteries are the type of blood vessels which carries the blood from the heart to the rest of the body parts. This condition results in heart diseases like heart stroke or heart attack due to abnormal blood flow.

3 0

3 years ago

Ad each question completely before writing your answer.

DanielleElmas [232]

Answer:

it is A neuron

Explanation:

may I get brainliest

8 0

3 years ago

Read 2 more answers

Metamorphic rocks used to be igneous and sedimentary rocks. They were changed into metamorphic rocks by