1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
What is the weakest bone in your body?​
nexus9112 [7]

Answer:

<u><em>stapes</em></u>

The stapes is the smallest and lightest bone in the human body and is so-called because of its resemblance to a stirrup (Latin: Stapes).

Explanation:

I hope that this answer has helped you to more thoroughly understand your question asked. If you have any further questions, please do not hesitate to ask them below.      

Have a great rest of your day/night!

8 0
3 years ago
Explain why cyclists, runners, and other endurance athletes train at high altitudes.
Sliva [168]

Answer:

higher altitudes have a lower level of oxygen which in turn, trains your lungs to hold and breathe more oxygen which also helps you cycle, run, etc. longer than usual

Explanation:

3 0
3 years ago
What happens when planaria is cut into pieces?
valkas [14]
Planaria<span> can be </span>cut<span> into pieces, and each piece can </span>regenerate<span> into a complete organism. crazy huh</span>
7 0
3 years ago
Which best describes the main role of nuclei acids in living things?
sveticcg [70]

Answer:

Nucleic acids are the most important macromolecules for the continuity of life. They carry the genetic blueprint of a cell and carry instructions for the functioning of the cell. The two main types of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Explanation:

dang it.

7 0
3 years ago
I need a little help (I'll give you brainliest), What is the problem with having plant life on Mars, and what is the solution to
LuckyWell [14K]

Answer:

The problem: Under Martian gravity, the soil can hold more water than on Earth, and water and nutrients within the soil would drain away more slowly. Some conditions would make it difficult for plants to grow on Mars. For example, Mars's extremely cold temperatures make life difficult to sustain.

Scientists have conducted plant experiments simulating Martian conditions using volcanic soil in Hawaii, which is known for its similarity to Martian soil. These experiments found that plants can actually grow in these soils.

There are other aspects future Mars explorers will need to consider when growing plants on that planet. As mentioned earlier, Mars’s atmosphere is mostly carbon dioxide, and plants need this gas just as much as we need oxygen to breathe.

4 0
3 years ago
Read 2 more answers
Other questions:
  • For a DNA strand that contains the sequence AGT in the 5’ to 3’ direction, what nucleotides are found on the other DNA strand in
    10·1 answer
  • ______ are perhaps best defined as eukaryotes that are not fungi animals or plants. bacteria protista monera none of the above
    12·1 answer
  • How does the control group setup in an experimental differ from the other setups in the same experiment?
    9·2 answers
  • How has the ride of oxygen changed life on planet Earth ?
    15·2 answers
  • When invaded by antigens, the body forms substances called?
    7·1 answer
  • These three questions​
    9·1 answer
  • The incidence of skin cancer has increased dramatically in parts of Australia where people are experiencing greater UV exposure
    12·1 answer
  • BIO AND SCIENCE EXPERTS PLS HELP OR ANYBODY I JUST NEED HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!pLSSSSS
    6·1 answer
  • PLEASE HELP!! 50 POINTS + BRAINLIEST
    6·2 answers
  • Enternal Supplememts Explore similarities
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!