1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
Biomes and aquatic ecosystems q
Inga [223]

Answer:

Biomes And Ecosystems. Free Shipping on Qualified Orders.

NIBIRU SPORT Ping Pong Paddle Set (4-Player Bundle), Pro Premium Rackets, 3 Star ...

amazon.com has been visited by 1M+ users in the past month

Shop Best Sellers · Shop Our Huge Selection · Read Ratings & Reviews · Explore Amazon Devices

Departments: Books, Industrial & Scientific, Kindle Store and more

Explanation:

5 0
3 years ago
Bacteria in your intestines are an example of mutualism if they
Fofino [41]

Answer: if they help you break down food

Explanation:

Mutualism is a biological relationship between TWO or more organisms of different species (inter-specie) in which one or more benefits.

A good example is bacteria in the human intestine that helps to break down cellulose contained in food, thus benefitting humans.

3 0
3 years ago
Which of the following mutations is evolutionarily important?
kompoz [17]
A gene in an egg cell inserts two extra base pairs!!
6 0
3 years ago
Read 2 more answers
How deep below Earth's surface do rocks melt?<br> A. 1000 km<br> B. 500 km <br> C. 50 km<br> D. 50 m
podryga [215]

Answer:

I say, it would really be around like 50-500km. Really, it would be 70km.

Explanation:

Magma rises with convective currents, then cools and spreads intent on form ocean-floor crust. The place to start for melting has lengthy been idea to be at <em>70 kilometers</em> under the seafloor.

6 0
3 years ago
Write a scientific claim to explain why Puerto Rico Experiences more
k0ka [10]

Answer:

Plate Boundaries

Explanation:

Puerto Rico might be on a plate boundary. When two plates slide against each other (also called a transform boundary) they can cause a earthquake to happen on the surface.

3 0
2 years ago
Other questions:
  • 16. Is a bear an ENDOTHERM or ECTOTHERM?
    10·1 answer
  • What type of changes does erosion cause?
    10·2 answers
  • Which substance reduces the level of acid in blood?<br> sodium<br> bicarbonate<br> urea<br> nitrogen
    7·1 answer
  • The chemical signal that travels through the bloodstream is part of the blank system
    10·1 answer
  • How does carbon-14 dating work?
    12·1 answer
  • The regional term for the forearm is _______ ;and the regional term for the shoulder blade is ________.
    10·1 answer
  • 1. Energy is the
    9·1 answer
  • What are abiotic things made of if they are not made of cells?
    13·1 answer
  • Use the terms below to complete the sequence of the levels of organization in a multicellular organism.
    13·1 answer
  • What are three ways that substances can be described?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!