1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
What is the Definition of life?
qaws [65]
The existence of a living human being 
7 0
3 years ago
Read 2 more answers
New Mexico has several renewable resources that it uses for energy. An example of a nonrenewable resource is
AleksandrR [38]
I could come up with multiple examples!

•Coal
•Natural gas
•Nuclear energy
•Petroleum


Hope this helped!
4 0
3 years ago
Read 2 more answers
What does the fossil record include and what can we learn from it?
AlexFokin [52]
By studying the fossil record we can tell how long life has existed on Earth, and how different plants and animals are related to each other. Often we can work out how and where they lived, and use this information to find out about ancient environments. Fossils can tell us a lot about the past.
7 0
3 years ago
2 haploid (N) daughter cells
timurjin [86]

Answer:

N daughter cells have half number of chromosomes and they are the result of meiosis I.

4 0
3 years ago
Why is subbituminous coal more popular than bituminous coal for electricity production even though it produces less heat?
ddd [48]

Answer:

Easier to extract, THE SECOND PART ISN'T                                                  LASTS LONGER

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • The pros and cons of the huge rock plug that is jammed into Mt. Vesuvius?
    5·1 answer
  • You discover a new type of gland associated with the skin. Chemical analysis of the product shows a secretion has a pH of 4, con
    11·1 answer
  • Which of the following describes how polluted water sources would most likely affect one’s personal health?
    5·2 answers
  • Under which type of change in the ecosystem ( fast change or slow change) would more organisms be able to survive and why?
    9·1 answer
  • Do Meiosis and Mitosis occur in all organisms?
    9·1 answer
  • Is it going to rain???
    11·2 answers
  • How does severe weather in Earth’s atmosphere affect Earth’s geosphere?
    10·1 answer
  • RIGHT ANSWER GETS BRAINLIEST!!
    6·2 answers
  • Plz help with this problem.
    12·1 answer
  • Clouds form when the water vapor in air condenses as
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!