1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
How many calories does a male or female need a day<br> (biomed)
Nikitich [7]

Answer:

An average woman needs to eat about 2000 calories per day to maintain, and 1500 calories to lose one pound of weight per week. An average man needs 2500 calories to maintain, and 2000 to lose one pound of weight per week. However, this depends on numerous factors.

Explanation:

7 0
3 years ago
Read 2 more answers
Jed was hospitalized for a hip surgery. he is eight years old, and is now exhibiting confusion about the time of day or day of w
Ivan

C. Delirium

He is getting surgery for his hip and was medicated. The medicine made him delirious, that why it only why he was in the hospital

3 0
3 years ago
Can someone help I don’t know
stellarik [79]

1. Female, white fur

2. Male, white fur

3. Male, white fur

4. Female, white fur

Q3.) 2 generations (parents and offspring)

8 0
2 years ago
An _____ is a drug that mimics or increases a neurotransmitter's effects, whereas an _____ is a drug that blocks a neurotransmit
alexdok [17]
Agonist/antagonist
 Agonist are drugs that bind and activate a receptor with effecting the response.If the effect results in maximum response it is considered as full agonist. However if the drug that binds to the receptor results only into partial efficacy in relation to the full activation of the receptor, this is considered as partial agonist.

Antagonist are drugs that blocks a biologic response of a hormone or another drug. They usually have affinity to the receptors but has no efficacy. This drug will just inhibit the activation of the receptors by the aganist.
5 0
2 years ago
What differs among DNA structures of different species?
weqwewe [10]

Answer:

D) the arrangement of the nucleotides within genes

Explanation:

De-oxy ribo nucleic acid that is basically a polymer of nucleotides. Nucleotides are composed of three basic units: a de-oxyribose sugar unit, a phosphate group and nitrogenous bases that can be Adenine, Gunanine, Thymine and Cytosine.Adenine always pairs with Thymine and Guanine always pairs with Cytosine.

This is a universal composition of DNA in each and every living organism. The genes are a segment of DNA that contain specific sequence of nucleotides and encode for a specific trait of organism such as height, weight, eye color etc. The sequence of nucleotides expresses the trait in the form of protein product during the process of Translation. The products of translation are amino acids and every amino acids encode for a specific protein  in almost  all living organisms.

So, what differs in the specie is the sequence of nucleotides in genes. Infact this is the nucleotide sequence which brings evolution in organism and organisms evolve to form new specie with the passage of time. One major cause of change in nucleotide sequence is mutations due to which the organisms change with time.

Suppose the sequence of nucleotide of specific gene in organism A is

AAGGGGAAATTT

However in other specie organism B of same specie is:

TAGGGGAAATTT

This means only mutation of one base changed the gene in organism B and also its product called protein.

Hope it help!

8 0
3 years ago
Read 2 more answers
Other questions:
  • Choose all statements that accurately describe the transcription bubble
    15·1 answer
  • If a dog has 72 chromosomes, how many daughter cells will be created during the single cell cycle? Each of these daughter cells
    13·1 answer
  • What cycle do the light-independent reactions use to turn carbon dioxide into glucose?
    11·2 answers
  • If you wanted to determine the phenotype of an organism, what procedure would you follow?
    12·1 answer
  • Cells specialization in the human body is usually due to ?
    10·1 answer
  • Your biology instructor has assigned you a lab exercise to test a hypothesis regarding the inheritance of stem length in pea pla
    7·2 answers
  • An example of the process of solvation would be a salt crystal dissolving in a
    14·1 answer
  • Since i'm so du/mb, and forgot what newtons 2nd law was can someone explain?
    8·2 answers
  • Explain how these competitors are benefiting from the SAA strike​
    9·1 answer
  • How are acids and protons related? (1 point)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!