1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
2 years ago
9

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Biology
1 answer:
torisob [31]2 years ago
5 0

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

You might be interested in
How does diabetes affect the blood flow in the cardiovascular system
xxMikexx [17]
The circulatory system is responsible for the delivery of blood

8 0
3 years ago
What are the four reasons that natural selection occurs?
rewona [7]

The four reasons are

1) There is an over population.

2) There is a genetic variation in certain offspring that is helpful to survival.

3) The species struggle for survival.

4) The ones that lives will reproduce and pass on their genetic variation.


I hope that's help:0

8 0
3 years ago
Tactile corpuscles respond to light touch. where would you expect to find tactile corpuscles? tactile corpuscles respond to ligh
kifflom [539]

The answer is ‘in the dermal papillae of hairless skin’. Dermal papillae is the layer of the skin (upper dermis) with numerous blood vessels and nerves that serve the epidermis of the skin. Tactile corpuscles (nerves) are mostly found in this region and occur mostly in hairless thick skin such as in finger and toe tips.


6 0
3 years ago
What effect would an increase in duckweed have on a pond ecosystem ?
vaieri [72.5K]

Answer:

c

Explanation:

3 0
3 years ago
Read 2 more answers
Which statement best explains why wastewater cannot be released into the environment without treatment?
Schach [20]

Answer:

It will remain comtaminated and toxic

Explanation:

7 0
3 years ago
Other questions:
  • Why is eating local food instead of food produced elsewhere often helpful to the environment?
    5·1 answer
  • Which of the following is true about the cell theory?
    5·2 answers
  • Which of the following has a closed circulatory system?
    15·2 answers
  • statement about stomata is true? A.The number of stomata is greater on the upper surface of the leaf. B.The number of stomata is
    10·1 answer
  • How are so few producers able to support so many primary consumers?
    12·1 answer
  • Organisme yang termasuk dalam kelompok heterotrof adalah..
    15·1 answer
  • What kind of living and non living things do you think a marine biologist studies
    8·1 answer
  • Which nutrient is required for the formation of collagen?
    5·1 answer
  • Paul is driving his car and he changes his velocity from 5 m/s to 15 m/s in 2 seconds. Is
    5·2 answers
  • when reading a book, the ciliary muscle will __________, the suspensory ligament will __________, and the lens will become more
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!