1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SIZIF [17.4K]
3 years ago
9

Ciliated larvae of monogeneans are called:

Biology
1 answer:
Lady_Fox [76]3 years ago
8 0
C. Muller's Larva :---)
You might be interested in
describe two ways that birds and reptiles differ. use two particular animals as example in your description. help!!!!!!
natita [175]
Birds such as eagles have feathers and reptiles such as a lizard has dry scaly skin. Birds are warm blooded, and reptiles are cold blooded.
3 0
3 years ago
What unit of measurement is most appropriate for measuring the size of atoms?
Naddika [18.5K]
A "micrometer" is the best unit of measurement for measuring the size of an atom. 
6 0
3 years ago
PLS HELP!! ILL MARK BRAINLIEST
True [87]

Answer:

1. While Biology is the study of living things, living things themselves are made up of chemical composition. Our survival is dependant on the reactions taking place inside and outside the body. Hence, to understand living things, biologists needs a good understanding of chemistry.

2. 170 pm is the radius of a Carbon Atom.

3. The vast majority of the mass of an atom is concentrated in its nucleus

4. Protons are found in the nucleus of the atom. This is a tiny, dense region at the center of the atom. Protons have a positive electrical charge of one (+1) and a mass of 1 atomic mass unit (amu), which is about 1.67×10−27 kilograms.

5. Neutrons are located with protons in the nucleus; they too exchange mesons with protons and with each other to form the strong nuclear force, but they do not have to overcome the repulsion from Coulomb forces since neutrons are not charged.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What is the role of spinder fibers in mitosis?
olga_2 [115]

Answer:

pindle fibers form a protein structure that divides the genetic material in a cell. The spindle is necessary to equally divide the chromosomes in a parental cell into two daughter cells during both types of nuclear division: mitosis and meiosis. During mitosis, the spindle fibers are called the mitotic spindle.

Explanation:

7 0
3 years ago
Other questions:
  • A company is testing a new weight-loss supplement. For the study, the company enrolled 189 obese or overweight middle-aged peopl
    10·2 answers
  • 5 things I learned from the amoeba sisters biological levels in biology
    7·2 answers
  • The statrum ____________ is a single layer of columnar or high cuboidal cells resting on a basement membrane. the stratum ______
    5·1 answer
  • During what stage of the cell cycle do sister chromatids line up in the middle ?
    8·2 answers
  • Suggest why drugs that prevent reflex action from occurring should be avoided
    12·1 answer
  • Theodor W. Engelmann illuminated a filament of algae with light that passed through a prism, thus exposing different segments of
    7·1 answer
  • Which part of a DN molecule represents encoded information?
    7·2 answers
  • Explain to me what a animal classification is
    7·2 answers
  • Con la Ley Nacional de Educación, el derecho a la educación, la equidad y la igualdad. Deben elaborar un breve texto (o frase) q
    9·1 answer
  • I will mark brainiest
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!