mit freundlichem Gruß or mit freundlichen Grüßen
(C.) The layers of the Earth are uniform in thickness
This is untrue. The mantle is far large than the crust and there are other large size differences.
Yes if have them in the refrigerator for a long time and then take them out and leave them on the counter for a good 2 days
<span>The thing that might happen to the tree was it might get swept away by the current until it catches on something or disappears (dissolves). The tree will going to the flow of the river until it catches on something where it may disappears or dissolve.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
