1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
6

The _______ is the total number of organisms that an ecosystem can support.

Biology
2 answers:
attashe74 [19]3 years ago
5 0
Under natural conditions, most populations will stabilize at a level known as the carrying capacity of the ecosystem<span>. The carrying capacity is the maximum </span>number of organisms that an ecosystem can support<span> on a continued basis.</span>
adoni [48]3 years ago
5 0
UMMMMMMMMMMMMMMMMMMMMMMMMMMM it is called the carrying capacity
You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Natural selection involves energetic trade-offs between ________. Group of answer choices high survival rates of offspring and t
koban [17]

Answer:

The correct answer is ''high survival rates of offspring and the cost of parental care''

Explanation:

Natural selection is the differential reproduction of some genetic variants with respect to others. Natural selection favors individuals who maximize their total reproductive success throughout life, that is, it favors certain phenotypes or variants are associated with greater offspring and / or greater survival, that also means that selection will favor those who stop spending on a particular breed at the right time to invest in another, that is, the amount of energy invested in each of them. This same natural selection also favors those genes that make it effective when the body that carries them is in development to extract all possible parental investment from their parents.

7 0
3 years ago
In the life-cycle of the malaria parasite plasmodium, where does fertilization and formation of the zygote occur?.
daser333 [38]

Fertilization and formation of the zygote occur Within the body of mosquito.

Zygote, from the Ancient Greek (zygtós), "attached, yoked," from (zygoun), "to join, to yoke," A fertilization between two gametes produces  a eukaryotic cell. The genome of a zygote, which consists of the DNA from each gamete, is what makes up a new individual creature and holds all of its genetic material.

The zygote is the first developmental stage in animals with many cells. When an egg cell and sperm cell unite to produce a new, distinct organism, a zygote is created in humans and the majority of other anisogamous species. With the aid of mitosis, the zygote can divide asexually in single-celled organisms to create identical progeny. The chloroplast DNA (cpDNA) of a Chlamydomonas zygote is inherited uniparentally from the parent with the mt+ mating type; as a result, such cells are typically uncommon. The mapping of chloroplast genetics through recombination was made possible by these uncommon biparental zygotes.

Learn more about Zygote here:

brainly.com/question/465851

#SPJ4

3 0
1 year ago
What part of the cell theory MOST implies that viruses, for all of their similarities to living cells, cannot be considered a li
-BARSIC- [3]
The asnwer to this D. Cells are the basic unit of structure and function in organism.
4 0
3 years ago
Read 2 more answers
Which one of the following statements correctly describes how stream terraces can form? Group of answer choices A temporary base
erik [133]

Answer: A

Explanation: A stream terrace basically forms through this process– Temporary base level is eliminated; the stream downcuts upstream from the old temporary base level, and the former floodplain is left well above the present elevation of the stream.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What does crop rotation do?
    10·2 answers
  • Why does Meiosis go through steps twice and divide twice?
    13·1 answer
  • Define cohesion in your own words. Give an example. Draw a picture.
    11·1 answer
  • how do the life functions of unicellular organisms and multicellular organisms compare in meeting the needs for life
    11·1 answer
  • Glucoses is a molecule that can move across the cell membrane.if the concentration of glucose is higher inside the cell than out
    8·1 answer
  • ¡Necesito ayuda! I need Help!
    10·2 answers
  • What is a parasitic relationship?
    15·2 answers
  • Upon completion of seeding a flower and a vegetable, research and identify the optimum propagation conditions, such as, water an
    5·1 answer
  • If the deer population is reduced which of the following organims will be affected by the reduction in the amount of energy prov
    7·2 answers
  • Part 2: Water Cycle
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!