1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PtichkaEL [24]
3 years ago
9

Blank lines are parallel and run blank?

Geography
1 answer:
allochka39001 [22]3 years ago
6 0
<span>Latitude lines are parallel and run left to right
</span><span>
Longitude lines are diagonal and run up and down

I remember this because when you say "longitude", your mouth moves up and down. 

Good luck!</span>
You might be interested in
How are babies made?
DanielleElmas [232]

1) Through fertilization of an egg.

2) .5

3) Their body ages faster then ours.

4) They're made of love. (Also known as organs, water, basically what we are made of like any mammal.)

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
#8 Is this the right answer I need help because I don’t want to get it wrong
ASHA 777 [7]

Answer:

B

Explanation:

Natural Resource is a source of energy that doesn't need any action from humans. The sun doesn't need the help of humans, therefore it is a natural resource

4 0
2 years ago
Read 2 more answers
What is the relationship between wealth and life expectancy?
Georgia [21]

Answer: Countries with more wealth have a higher life expectancy

Explanation: Countries with more wealth can have more money to spend on healthcare.

4 0
1 year ago
Which of the following oceans lies between North America South America Europe and Africa?
zimovet [89]
The Atlantic Ocean lies between North America South America Europe and Africa
4 0
3 years ago
Read 2 more answers
Other questions:
  • Give me three least examples EACH OF PRIMARY AND SECONADRY SOURCES
    15·1 answer
  • What are landforms and how do I apply them on a picture
    9·1 answer
  • The peregrine falcon is an example of
    13·1 answer
  • How did the implementation of unit pricing in san jose affect the amount of garbage sent to landfills?
    12·1 answer
  • What resource accounts for roughly 90% of Botswana's export earnings?
    14·1 answer
  • Where is Georgia located?
    9·1 answer
  • 2
    12·1 answer
  • Describe 3 types of plate boundaries where volcanic eruptions can occur.
    15·1 answer
  • One word answer transportation of logs
    5·1 answer
  • 10 importance of highland<br>please I need the answers ASAP!! ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!