Answer: B. Fox nests
Explanation:
Foxes dig out dens to provide a safe underground space that is mostly used for raising fox cubs, also called kits. In urban areas, the dens - known as earths - are commonly located under sheds, but they can also be among tree roots, in bushes or on railway embankments.
Answer: It is important that cells have a "control system" because without it cells would either divide too fast or cause tumors to grow (cancer), or divide too slow and not be able to perform their cellular functions which is why the cells are controlled.
Answer:
True.
Explanation:
White blood cells cannot function properly and their reduced production can lead to fever and frequent infections. This is because the function of white blood cells in fighting germs has been disrupted.
Other signs and symptoms:
- Weak and tired.
- Lack of appetite and weight loss.
- Swelling and bleeding gums.
- Headache.
- Abdominal swelling is caused by enlargement of the liver and lymph.
- Bone pain, can cause weakness.
Joint pain.
- The glands are swollen. If the glands in the neck and chest are swollen, it can cause blood flow to be blocked. This causes the face to swell, difficulty breathing and snoring.
#If i'm wrong, i'm sorry
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
3 materials
Explanation:
The jacket and trousers worn by a firefighter have to be constructed from materials that will withstand intense heat. Aramid fiber is a synthetic fiber that is highly regarded for its strength and heat resistance. Nomex is the trade name for arimid fiber clothing, and this type of material is used in the construction of a firefighter jacket and trousers. Nomex is often combined with Kevlar to increase the strength of the material.
