1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
3 years ago
15

Imagine that an entire forest wipped out by a large fire , how would it effrct the cycling of matter

Biology
1 answer:
irina [24]3 years ago
6 0
1. Any cone-bearing trees would release their seeds. These trees make the fires advantageous to their species by having the seeds "explode" when heat touches the cones.

2. The ashes from the burned trees would help nourish the released seeds.

3. New wildlife will begin as the baby trees develop and grow
You might be interested in
How do disease caused by bacteria and disease caused by viruses react to antibiotics
kipiarov [429]

Many human illnesses are caused by infection with either bacteria or viruses. Most bacterial diseases can be treated with antibiotics, although antibiotic-resistant strains are starting to emerge. Viruses pose a challenge to the body's immune system because they hide inside cells.

6 0
4 years ago
Read 2 more answers
Explain the carbon dioxide cycle. Use the words photosynthesis and respiration in your answer.
vovikov84 [41]
DO You Still need an anwser to this question

7 0
3 years ago
Lesson 2 energy flow in ecosystems quiz
frosja888 [35]
Evehhdndjydudrjhfudusuhrhfudatvehfisyye
4 0
3 years ago
Deep-oceanic trenches are formed a subduction
miskamm [114]

Answer:

Convergent

Explanation:

In particular, ocean trenches are a feature of convergent plate boundaries, where two or more tectonic plates meet. At many convergent plate boundaries, dense lithosphere melts or slides beneath less-dense lithosphere in a process called subduction, creating a trench.

7 0
3 years ago
A recessive allele causes phenylketonuria (PKU) when homozygote. If the frequency of the recessive allele is 0.05 in the populat
Radda [10]

Answer:

0.095

Explanation:

Phenylkentonuria is a disease caused by a recessive allele.

The frequency of the recessive allele + the frequency of the dominant allele equals 1.

The frequency of the recessive allele is q = 0.05

The frequency of the dominant allele then is p = 1  - q = 0.95

If people mate randomly, the frequency of the homozygous dominant genotype will be p², the frequency of the heterozygous genotype will be 2pq and the frequency of the homozygous recessive genotype will be q² .

2pq=2× 0.05 × 0.95

2pq=0.095

The heterozygote frequency in the population is 0.095

4 0
3 years ago
Other questions:
  • As water enters this plant cell structure, the cell becomes more turgid. This plant cell structure is the A) vacuole. B) cytopla
    6·2 answers
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • What 3 factors that affect surface ocean current?
    7·2 answers
  • Briefly describe the DNA transcription process, which involves the transfer of the DNA genetic code onto an mRNA molecule. Inclu
    7·1 answer
  • A magnetic pole is the part of a magnet where the magnetic effect is weakest
    14·2 answers
  • Explain the difference between a seamount and a volcanic island.
    11·2 answers
  • Describe some of the effects that contracted blood vessels will have on blood pressure.
    12·1 answer
  • PLSSS HELP IF I GET IT RIGHT 30 POINTS FOR BRAINLIEST!!!​
    6·2 answers
  • PLEASE ANSWER.
    15·2 answers
  • Why does sexual reproduction process create offspring with genetic variation (different genes between parents and siblings)?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!