1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
8

Sarah recently learned about performing a cost–benefit analysis while studying environmental policies. Help her choose the right

terms to describe this type of analysis. Based on a cost–benefit analysis, society’s cost incurred due to____will be reduced as the amount of pollution____. However, at the same time, the cost of pollution control will increase.
Biology
2 answers:
kipiarov [429]3 years ago
7 0

Answer:

<em>I can see that there are no choices given, so I have answered the question according to my understanding.</em>

Based on a cost-benefit analysis, society's cost incurred due to social benefits will be reduced as the amount of pollution decreases.

Explanation:

When it comes to "cost-benefit analysis," the analysts weighs the benefits and costs all together. By doing so, he'll be able to subtract the cost from doing the action that provided a benefit or solution. This analysis is very important in order for the company to know whether the project they are pursuing is feasible.

A society's cost happens in response to a particular action that was taken for the society's benefit. This will be reduced once the pollution in the place also decreases. The society's cost here would mean "new business strategies" that would lower the pollution. So, these include the private costs of firms. On the other hand, the cost of pollution control will increase which means that the firms need to add external costs in order to make their products environment-friendly (and so to control pollution). So, this means that<em> the company will be producing less of the product because it will be priced highly</em>.

Alexandra [31]3 years ago
7 0

production, decreases

You might be interested in
Segments of chromosomes that contain coded información for an organism's traits are called?
marissa [1.9K]
I think the answer is genes
3 0
3 years ago
matter and energy move through ecosystems between different organisms. how does matter travel through an ecosystem and through e
choli [55]

Answer: In ecosystems, matter and energy are transferred from one form to another. Matter refers to all of the living and nonliving things in that environment. Nutrients and living matter are passed from producers to consumers, then broken down by decomposers. Decomposers break down dead plant and animal matter.

Explanation:

6 0
3 years ago
is a mathematical modeling approach to predicting the outcome of natural selection on behaviors when multiple organisms are inte
Art [367]

Evolutionary game theory is a mathematical modeling approach to predicting the outcome of natural selection on behaviours when multiple organisms are interacting.

<h3>What is natural selection? </h3>

According to modern concept of evolution natural selection is not a bloody battle as was emphasized by Darwin and Wallace.

It is a peaceful process that has little to do with, "struggle for existence" or "elimination of unfit" or "survival of the fittest".

Natural selection really means differential reproduction ( some members of the population produce lage no of offspring, some are few and still others none.

Those that produce large no of offspring contribute greater percentage of genes to the gene pool of the next generation than those that produce fewer offspring.

If differential reproduction continues for many generation ,then genes of the individual which produce more offspring will become predominant in the gene pool of the population.

This leads to change in the gene frequency of the population.

Individual which are best adopted to the environment having greater no of surviving ones.

Survival of the organism to the reproductive age and their selection for mating is the important factors which results in differential reproduction.

There are three types of natural selection stabilizing

selection, directional selection and disruptive selection.

Learn more about natural selection here :

brainly.com/question/6981381

#SPJ4

7 0
2 years ago
Life-cycle analysis is useful because energy and environmental hazards are associated with
Oxana [17]
Production, transport, use and disposals
3 0
4 years ago
As the temperature drops, a cold-blooded animal is likely to
cricket20 [7]
A. slow down as a response to the cooling temperature

HOPE IT HELPS UH!!☺️☺️
7 0
3 years ago
Other questions:
  • This image displays what type of fault?
    15·1 answer
  • A lion eats a zebra is an example of which characteristic of life
    6·2 answers
  • What are some factors in an environment that can affect carrying capacity
    5·1 answer
  • A primigravid client at 38 weeks' gestation is admitted to the labor suite in active labor. the client's physical assessment rev
    12·1 answer
  • What's the relationship between photosynthesis and cellular respiration
    5·2 answers
  • What are two advantages that locomotion gives to an organism?
    5·1 answer
  • Explain how the Earth itself is a system and describe an example of an interaction within this system.
    6·1 answer
  • Olestra, a synthetic fat used to make potato chips, _____________
    13·1 answer
  • According to the envelope in Model 1, who is supposed to receive the letter?
    5·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!