1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
2 years ago
9

Why do scientists believe that winters might be milder on the Eastern Seaboard in the future?

Biology
1 answer:
boyakko [2]2 years ago
8 0

Explanation:

D. A change in the amount of polar ice will alter how ocean currents move.

You might be interested in
Which is mixed with proteins to break them into amino acids? villi enzymes saliva fat
postnew [5]

Answer:enzymes

Explanation:during digestion, food is broken down by chewing in the mouth.enzymes also acts on foods to reduce them into simpler constituents.enzymes acts on food in the mouth, stomach, intestine etc.

Enzymes that acts on proteins helps to break the peptides bonds present in proteins.they break up the polypeptide chains into amino acids .An example is trypsin .the conditions necessary for these enzymes to acts may be specific.some require acidic environment while others require basic environment.pepsin for example requires stomach hydrochloric acid to be converted from it's inactive form, pepsinogen.

The resultant Amino acids are then absorbed in the small intestine

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which type of teeth do mammals use for grinding plants?
Bond [772]
I think the answer is molars
4 0
3 years ago
In horses, Chesnut hair color is recessive to black. The pacing gait is recessive to trotting and long hair is recessive to shor
Vitek1552 [10]

9:3: 3:1  is the phenotypic ratio showing traits as black and long hair : black and short hair: chestnut and long hair: chestnut and short hair when a chestnut horse heterozygous for pacing and hair length with a hybrid horse.

Explanation:

Dominant trait = black hair colour (BB,Bb), trotting (TT,Tt) , long hair (LL,Ll)

recessive trait = chesnut hair colour (bb), pacing gait (tt), short hair(ll)

cross between chestnut horse heterozygous for pacing and hair length will have alleles as BbLl

alleles for hybrid horse will also be heterozygous Bb, Ll

Punnett square to show the cross:

      BL         Bl       bL         bl

BL  BBLL  BBLl     BbLL    BbLl

Bl   BBLl    BBll     BbLl      Bbll

bL  BbLL  BbLl      bbLL     bbLl

bl    BbLl  Bbll       bblL        bbll

phenotype ratio

black and long hair : black and short hair: chestnut and long hair: chestnut and short hair

9:3: 3:1  is the phenotype ratio.

3 0
3 years ago
Which answer best explains how most scientists think that planets form? A. Large chunks of matter break off a star that collides
zloy xaker [14]

Answer: B

Explanation:

Thats what the teacher told me

7 0
3 years ago
Other questions:
  • Which is the most common type of arthritis, resulting from wear and tear of joints over the years?
    14·2 answers
  • Take a break from work and stress and tell me how your day is going! I wanna know :)
    7·2 answers
  • Explain what occurs in cell differentiation and morphogenesis
    14·1 answer
  • The land and water ecosystems that provide the resources that a person uses and that neutralize that person’s wastes is part of
    14·1 answer
  • Robert decides to go for a run when he gets home from school. As he begins running, his breathing rate starts to increase. What
    10·1 answer
  • 8. Albinism is a harmful mutation where animals are completely white. This mutation is harmful because individuals are more easi
    15·1 answer
  • If a promoter is found within a nucleosome, how would it be possible to express that gene if needed?
    14·1 answer
  • Pls help
    15·1 answer
  • Atherosclerosis is a condition where hardening plaque forms in damaged areas of the arteries. As the amount of plaque increases,
    11·1 answer
  • Which of the following statements about the deciduous forests is true​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!