1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
What is the main function of meiosis?
Delicious77 [7]
The answer for this should be D
7 0
3 years ago
Read 2 more answers
The cells in this part of a plant form long, vertical tubes. What is the most
Soloha48 [4]

Answer:

The cells present in the stem are part of the xylem and phloem conductive tissues. They are characterized by being elongated and in tubular form because they transport the substances, the xylem transports  water and  inorganic mineral sales that the root absorbs from the soil. The phloem is responsible for transporting substances synthesized in photosynthesis.

Its tubular and elongated shape facilitates the transport of these substances

7 0
3 years ago
Identify the living and non-living parts of the nitrogen cycle.
Softa [21]

Answer:

The nitrogen cycle is a repeating cycle of processes during which nitrogen moves through both living and non-living things: the atmosphere, soil, water, plants, animals and bacteria. In order to move through the different parts of the cycle, nitrogen must change forms.

7 0
3 years ago
Read 2 more answers
Which of the following characteristics of protein will remain intact if the protein is denatured?
Vesna [10]
E.the number of amino acids in the protein
7 0
3 years ago
Read 2 more answers
Which of the following particles has a negative charge?
Stells [14]

Answer:

C. Electron (e-) has a negative charge

8 0
3 years ago
Read 2 more answers
Other questions:
  • When is cladistics more useful than Linnaean taxonomy?
    8·2 answers
  • Someone please help me i really need a good score
    10·1 answer
  • Do you think the phases of the moon follow a pattern ? Explain
    10·1 answer
  • Which differentiates the key chemical properties of nucleic acids, DNA and RNA?
    9·2 answers
  • The biodiversity and distribution of penguin species in the Antarctic Peninsula are changing as sea ice disappears. This is most
    12·2 answers
  • The interaction between a flea and a dog is classified as _________.​
    5·2 answers
  • What is Clubfoot and how you get it?
    5·1 answer
  • What is the most likely function of this structure?
    5·2 answers
  • Analyze the scatterplot graph.<br><br><br><br> Which trend does the graph show?
    9·1 answer
  • . Which of the following is NOT a characteristic of life?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!