1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
4 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]4 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
A child has blue eyes whereas his mother has brown eyes. Which of the following explains why the child has blue eyes?
marishachu [46]
C-A piece of DNA from the father carried the trait for blue eye color.
6 0
3 years ago
Read 2 more answers
Please select the word from the list that best fits the definition measures temperature​
Artist 52 [7]

Answer:

Thermometer

Explanation:

I did the test and that was the only thing I could think of

8 0
3 years ago
Which of the following show an element of the sample space for shooting 2 free throws in basketball? (X = Make, O = Miss)
PSYCHO15rus [73]
Each choice show an element of the sample space for shooting 2 free throws in basketball.

A. XX - the 2 free throws made the basket
B. OO - the 2 free throws missed the basket
C. XO - 1st free throw made the basket, 2nd free throw missed it.
D. OX - 1st free throw missed the basket, 2nd free throw made it.
7 0
3 years ago
"DNA replication is not considered a semi-conservative process."<br> True or false
Stels [109]

Answer:

False

Explanation:

4 0
3 years ago
If the tubes of the tracheal system in insects were longer, this would _______.
ella [17]
D) if the tubes of the tracheal system in insects were longer, this would cause oxygen to reach the cells more slowly due to the distance factor

5 0
3 years ago
Other questions:
  • In order for a hypothesis to become a theory,scientists must
    14·1 answer
  • Which kind of activity is pressing your palms against a wall with full force?
    15·1 answer
  • An area experiences a long period of drought, forcing towns to pump out almost all of the water held in aquifers. What is the mo
    11·1 answer
  • As a general rule for treating soreness and pain
    14·1 answer
  • What affects do end products have on enzymes
    5·1 answer
  • What does luster tell about a mineral? a. How hard it is c. If it is metallic b. How old it is d. If it contains iron
    5·1 answer
  • Balanced chemical equation for ethanoic acid​
    10·1 answer
  • What is one process responsible for decreasing the amount of Carbon in the<br> Atmosphere?
    5·1 answer
  • There is a species of frog on an island that puzzles scientists. The proportion of frogs with no stripes is greater than the pro
    12·1 answer
  • What are the advantages and disadvantages of anaerobic fermentation?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!