1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
Question 5
pantera1 [17]

Answer:

The solubility of a gas in a liquid occurs faster if the liquid is cooled. Hence the correct answer is option B.

Explanation:

The solubility of a gas in a liquid occurs faster than a solid. Solid solute takes much time to be dissolved in a solvent. This is because of the bonding. The bond of the solid is is much stronger when compared to the gaseous state. This is one of the reasons of gaseous dissolving faster than solid.

A gaseous state is defined as a material whose atoms are not closely attached with one another and is free to move in any direction. And when we have to mix gas in a liquid in a faster rate the liquid temperature should be lowered.

4 0
3 years ago
The last few miles of the marathon are the most difficult for Heather. Her hair is plastered to her head, sweat clings to her ar
Vlad [161]

Answer:

heat.

Explanation:

8 0
3 years ago
Which Organism Appeared On Earth First?
shepuryov [24]

A is the best answer

3 0
2 years ago
What are two ways that Prokaryotic and Eukaryotic cells are different?
Crank
1. Eukrayotes cells contain membrane-bound organelles, such as the nucleus, while prokaryotes cells do not. 

2. Eukaryotes are often multicellular whilst prokaryotes are unicellular. Although there are some exceptions –unicellular eukaryotes include amoebas, paramecium, yeast.

hope this helps!
6 0
3 years ago
In a large population of randomly breeding foxes, a dominant allele results in a soft, brown pelt, while a recessive allele resu
Sindrei [870]

Answer:

The frequency of the recessive allele which codes for grey pelt character will rise above 20%, while the that of the dominant allele that confers brown pelt character will decrease below 80%.

Explanation:

Since the population of foxes with brown pelts are being selectively hunted by humans, the population of foxes with brown pelts will keep reducing while the population of foxes with grey pelt will thrive in its place.

<em>Hence, the the frequency of the recessive allele which confers grey pelt attribute will rise above original 20% within the population, while the dominant allele will decrease below 80%.</em>

4 0
3 years ago
Other questions:
  • More than one million years ago, a single species of finch migrated to the Galapagos from the mainland of Central or South Ameri
    5·1 answer
  • Cell_____is the process by which cells divide​
    11·1 answer
  • Why are people with sickle-cell traits resistant to malaria
    7·1 answer
  • Cell speclization occurs by the process of
    5·1 answer
  • The karner blue butterfly lays its eggs on wild lupine plants. when the larvae hatch, they feed exclusively on the wild lupine.
    5·1 answer
  • molecules in all organisms are composed in part of radioactive carbon-14. which statement best explains the presence of carbon-1
    12·1 answer
  • Aminoglycosides: Select one: a. attach to the 30S ribosomal subunit and disrupt protein synthesis. b. are metabolic analogs of P
    7·1 answer
  • Which of the following would be considered an allele, check all that apply
    11·1 answer
  • Anyone have tips for taking care of bonsai??
    11·2 answers
  • Why is altruism a part of pro social behavior
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!