1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
4 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]4 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
I NEED HELP PLSSSSSS:PPPPP
Firlakuza [10]

Answer:

Lake

Explanation:

8 0
3 years ago
Read 2 more answers
20. Sickle cell anemia is a genetic disease caused by an autosomal recessive gene. If each parent carries one sickle cell
frosja888 [35]
Three would be an 25 percent chance
5 0
3 years ago
All organisms on earth share certain characteristics, but an actual definition of life is not simple. Why?
algol13

Answer:

An <em>organism </em>is any individual living thing but the definition of life is not simple because humans determine what meets the criteria of living and nonliving. However, this does not mean that humans are perfect when it comes to categorization. Viruses fall into a middle area between being classified as living or nonliving since viruses have some, but not all, of the characteristics required to be classified as living.

~Hope this Helps!~

8 0
3 years ago
The cell membrane of the red blood cell will allow water, carbon dioxide, oxygen, and glucose to pass through. Because other sub
Alex73 [517]

Answer: semi-permeable membrane

Explanation:

3 0
4 years ago
Under which condition below would you expect a glassy extrusive rock like obsidian to form
vagabundo [1.1K]
Obsidian is an extrusive rock that is formed when magma from underneath the Earth's crust breaches and becomes lava. Once the lava starts cooling, it solidifies and elements are frozen, giving the rock its glassy appearance.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the element that every like thing contains
    5·1 answer
  • Low ph alters hemoglobin structure so that oxygen binds less strongly to hemoglobin at low po2. this increases the effectiveness
    13·1 answer
  • A 10-newton object displaces 12 newtons of water. will thisobject sink or float?
    10·1 answer
  • what is the difference in the amount of genetic information found in a gamete compared to other cells in the body?
    13·1 answer
  • List the 5 things that plants must have/do to survive on land.
    11·1 answer
  • Which statement accurately describes the movement of Earth's plates due to convection currents?
    11·2 answers
  • The Human Genome Project was begun in 1988 by scientists from 13 nations as a worldwide effort to understand the sequencing of a
    14·1 answer
  • Both prokaryotic and eukaryotic cells have a cell membrane<br> true or false
    5·1 answer
  • Help please will give brainliest to anyone who is good at ​
    13·1 answer
  • Describe the movement of the water molecules at hot temperatures.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!