1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
How many X chromosomes do males have? _______
Andreyy89

Answer:

There are 2 sex chromosomes – X and Y. Females have 22 autosomes and two X chromosomes, i.e., 22 + XX, while males have 22 autosomes and an X and Y chromosome each, i.e., 22 + XY. hope it helps.

basically 22

Explanation:

3 0
3 years ago
Read 2 more answers
What is the main difference between the central nervous system (CNS) and the peripheral nervous system (PNS)?
Paladinen [302]
The CNS involves the brain and spinal cord and the PNS involves the body nerves.
6 0
3 years ago
Read 2 more answers
Birds cause a lot of damage to airplanes every year to study this problem the US Air Force infinity chicken canon Air Force scie
Debora [2.8K]
Picture ?? More detail please
4 0
3 years ago
Read 2 more answers
When the sun impacts weather, an interaction with the __________ takes place.HELP ME!!!!
IgorLugansk [536]

Answer:

hydrosphere

Explanation:

6 0
3 years ago
Read 2 more answers
If locusts killed off most of the plants in a region the carrying capacity for most organsms would
aleksandr82 [10.1K]
The carrying capacity would *decrease*, as there are less plants for organisms to eat.
5 0
3 years ago
Other questions:
  • What is the maximum number of covalent bonds a carbon atom can form with other atoms
    6·1 answer
  • Which of the following answer choices would be a sex chromosome aneuploidy in a human? Choose 1 answer: Choose 1 answer: A A spe
    10·1 answer
  • Why did early investigators predict that there must be a reduction division in the sexual reproduction process?
    12·1 answer
  • Ecological blank are a collection of plants,animals, and microorganisms residing in a habitat
    7·1 answer
  • You analyze a DNA sample and find that its base composition is 30% A, 20% T, 30% G, and 20% C. What can you conclude about the s
    9·1 answer
  • Pet owners have abandoned their Burmese pythons in the Everglades. Native species of frogs and reptiles decrease with the introd
    12·2 answers
  • Food web
    6·1 answer
  • At first glance, it might seem counterintuitive with respect to energy use that many sharks must swim continuously or they will
    11·2 answers
  • What does evidence show about radial symmetry in invertebrates? a. all invertebrates with radial symmetry are closely related b.
    8·1 answer
  • Which of the following aquatic ecosystems is likely to have both a littoral and benthic zone?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!