1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
Blood supply to an arm is cut off. Blood in the arm is sampled after
loris [4]

Answer:

Blood Flow restriction training involves cutting off 50-80% of arterial ... Blood Flow restriction can be used on the arm or leg and the tourniquet is ... minutes, which is enough time to induce a hypertrophy response, but will not cause limb damage. ... Back; 3D Run Analysis · Dry Needling · Weightlifting Analysis

Explanation:

6 0
2 years ago
A tadpole will lose its tail as it grows into an adult. Which cell structure in the tail of the tadpole cause this change to occ
timurjin [86]
The answer you are looking for is A 
6 0
3 years ago
Read 2 more answers
What is one of the main advantages of asexual reproduction?
andreyandreev [35.5K]

Answer:

There is a smaller chance of mutation.

Explanation:

5 0
2 years ago
What two main hormones does the pituitary gland produce?
tigry1 [53]
ACTH and TSH

Source: http://www.juniordentist.com/hormones-released-from-pituitary-gland-and-their-functions.html
5 0
3 years ago
To which phase of disposal of stolen goods does altering serial numbers belong
frutty [35]
The alteration of serial numbers belong to the "Recovery of stolen electrical goods" phase.

NC, sterilization or removing a serial range is usually charged as a secondary offense aboard a thievery offense. Generally, a person who alters or removes a serial range is doing this to hide the actual fact that they either scarf the property or received transferred possession. As such, there's a public interest in toilsome people who have interaction during this activity.
3 0
2 years ago
Other questions:
  • Which process results in the formation of a new<br><br> cell with a full set of chromosomes?
    10·2 answers
  • Arrange the following terms in the correct order: Fertilization, sex cells, meiosis, zygote, mitosis.
    10·1 answer
  • Which description accurately compares cellular respiration and photosynthesis?
    12·1 answer
  • Having had only one prenatal visit, a 16-year-old primigravida at 37 weeks' gestation is admitted to the hospital in active labo
    7·2 answers
  • 3.88 milligrams is equal to how many centigrams?
    5·2 answers
  • Definition! Help please!! I give brainliast please help meeee
    9·2 answers
  • Which mealworm behaviors were reflexes
    13·1 answer
  • What role does intraspecies competition play in natural selection?
    6·1 answer
  • How does cellular differentiation benefit complex organisms?
    11·2 answers
  • Glucose is an important biomolecule. Which of these statements is true regarding the movement of glucose into and out of cells?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!