1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
What defines a plant? Be specific
Elan Coil [88]

What defines a plant is if it alive, and leaves or contains pollen or seeds I hope this helps and is correct

8 0
3 years ago
Read 2 more answers
Which two processes are most likely to contribute to global climate change?
Alex787 [66]
C and a i’m pretty sure sure!
7 0
3 years ago
Read 2 more answers
HELPPPOPPPPPPPPPpppppp
masya89 [10]

Answer:

SeA URCHINS (SOOOOOOOOOOOOOOO SURE ABOUT MY ANSWER) dont blame me if you get it wrong because i said im sure

Explanation:

8 0
3 years ago
Hydrogen peroxide is a harmful by-product of normal metabolic activity. In order to prevent damage, hydrogen peroxide must be br
earnstyle [38]
A substance called "catalyst" can help speed up the decomposition of hydrogen peroxide. 
7 0
3 years ago
Read 2 more answers
Need help with my review, will give brainliest to anyone who gives a decent explanation to their answer.
sweet [91]

Second stage of cellular respiration is

The stage happens in mitochondria.

Oxygen combines with small molecules.

Energy is released.

<u>Explanation:</u>

Krebs cycle is the another name for second stage of cellular respiration . Throughout this stage, pair of molecules of ATP are generated. Another energy-storing molecules are also produced.  Into the mitochondrial matrix which is the deepest part of mitochondria, all pyruvate from glycolysis (from first stage) moves.

The Krebs cycle lacks oxygen. Anything that requires oxygen is represented as aerobic. The oxygen blends with the carbon from the pyruvate molecules. This creates carbon dioxide, a waste product. As a result of second stage NADH is generated.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The theory of plate tectonics helps to explain ____.
    12·2 answers
  • What percentage of genetic material is the same in everyone?
    14·1 answer
  • A high pitch always corresponds to
    12·1 answer
  • What happens after water vapor turns back to liquid
    11·1 answer
  • Binary fission is a form of reproduction
    5·2 answers
  • Need to know about plants and animal cells
    5·2 answers
  • Create the complementary DNA strand: CTA GTT ACG GTC AAG
    12·1 answer
  • Which part of the wave is changed when there is interference?
    9·1 answer
  • True or False
    11·1 answer
  • In fruit flies, long wings (W) is dominant over short wings (w). A purebred long fruit fly is crossed with a purebred short. Wha
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!