1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
The sequence of
Anna71 [15]

Answer:Proteins

Explanation:

DNA sequences make up amino acids which will make up proteins.  

8 0
3 years ago
An otherwise healthy 40-year-old man was in a car accident that caused damage to his right kidney, and the organ had to be remov
Brrunno [24]
The answer is that his blood pressure could increase. 

It is known that one of the functions of the kidney is to control blood volume. But, when one kidney is removed, the other one that remained must work for the both. So, the one remained kidney will try to control increased blood pressure, but if the one is not kidney is not enough, it could lead to increase of the blood pressure of the patient.
5 0
3 years ago
A dependent variable is:
valina [46]

Answer:

the variable that is being measured or tested in an experiment

Explanation:

just fax

5 0
3 years ago
Read 2 more answers
Which choice is an example of kinetic energy changing into potential energy?
AlekseyPX
277273838282828283773 jsjsjsjajsjjsjsjwjsjejjs


Want answers lol sry
5 0
3 years ago
300 years ago, how much carbon was being added to the atmosphere
dedylja [7]

Answer:

Explanation:

The global average atmospheric carbon dioxide in 2019 was 409.8 parts per million (ppm for short), with a range of uncertainty of plus or minus 0.1 ppm. Carbon dioxide levels today are higher than at any point in at least the past 800,000 years.

3 0
2 years ago
Other questions:
  • Conservationists establish that the minimal viable population of a population of tigers in an extensive geographical area is 16.
    15·2 answers
  • Which tool would be likely to provide the most accurate measurement of time in a laboratory experiment involving sprinting times
    15·2 answers
  • Molecules that contain carbon and make up livin things
    7·1 answer
  • A blank contains all the instructions that are needed to build an organism​
    12·2 answers
  • If a species makes up a small portion of the community by weight, yet exerts a disproportionate influence on community diversity
    6·1 answer
  • Which statement is correct about a euglena and a white blood cell? (1 point) A euglena cannot survive on its own because it is j
    13·1 answer
  • How are biotic factors in the marine ecosystem responsible for bringing carbon-dioxide into the ocean?
    7·1 answer
  • What form of matter is made from only one type of atom?
    8·2 answers
  • Which statement is a hypothesis that might be tested by observing a desert animal's
    10·1 answer
  • How does the change in temperature affect pepsin?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!