1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
The islands of the hawaiian chain are an excellent example of a series of
hram777 [196]
Answer: Shield volcanoes

----

Many of Hawaii's main islands are all famous examples of shield volcanoes. Hawaii itself is a large hotspot, which is a part of earth's surface that has multiple volcanoes.<span />
7 0
3 years ago
The most nutrient-poor soils are found in _____ biomes.
amm1812
   I believe it is tundra.
3 0
3 years ago
Read 2 more answers
Shelled protozoans become a part of _________________ layers
Katarina [22]
Shelled protozoans became part of 7 layers
8 0
2 years ago
Which of the following statements about monsoons are correct?
Arturiano [62]
Monsoon climate is generally great for rice farming, but monsoon floods can cause devastating landslides and floods. 
7 0
2 years ago
A shark and a dolphin have similarly shaped bodies and fins. However, these two organisms are not closely related: The shark is
algol13

Answer:

The preferable option will be - A.

A. similar environments and specific traits increased their chances of survival.

Explanation:

  • The shark and dolphins have similar body shape and fins. But shark is a fish and dolphin is a mammal.
  • Both of them are exposed to similar kind of environments. Both of them possess a specific kind of alternative characters and traits.  
  • So, Some species may have similar body structures even if they are not related because they evolved in similar environments and specific traits increased their chances of survival.

 

7 0
2 years ago
Other questions:
  • Determine the DNA sequence from which this mRNA sequence was transcribed
    6·1 answer
  • What determines whether or not a body system is likely to remain in a phylum over the course of evolution
    10·1 answer
  • The pedigree on the right shows the inheritance pattern for an X-linked recessive disorder. The mother of the individuals circle
    10·2 answers
  • In which part of the galaxy is the sun located?
    14·2 answers
  • Agenesis of the corpus callosum is a rare birth defect characterized by a lack of development of the corpus callosum. What sort
    8·1 answer
  • Where do most phosphates and nitrates in the Chesapeake Bay come from?
    15·2 answers
  • a mimic octopus has lost some of its arms, and is in the process of regeneration. Describe a scenario where this ability would p
    7·1 answer
  • What are the similarities and differences in the types of DNA?
    13·1 answer
  • 10. Which of the following BEST describes urbanization?
    12·1 answer
  • 1. Name the living things that make food for themselves and provide food for others
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!