1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
Why are autotrophs considered the basis of the food chain?
jolli1 [7]
They are among the only types of organisms that get their energy from a non-living thing, and they give energy to Primary consumers, which give energy to secondary consumers, which give energy to tertiary consumers, which can give energy to decomposers, etc.
6 0
3 years ago
All I ask is for ☝️one favor please. Describe how limiting factors has an impact on population of species
andrew-mc [135]

Answer: It can decrease or increase a population of species.

Explanation: Limiting factors include the availability of food, water, shelter, and etc. When a population of species are limited in any of these, they either move or adapt to their environment. So, population tends to decrease. The population that may finds an abundance of resources will find that their numbers tend to increase. This cycle is repeated over and over again.

Hope this helps!!!

7 0
3 years ago
Choose all the answers that apply.
patriot [66]
Is caused by vibration, can travel through a vacum, and travels in longitudinal waves<span />
5 0
3 years ago
Read 2 more answers
1. According to the graph below, what temperature will result in the highest rate of photosynthesis? A. 5°C
UNO [17]
<h3>✽ - - - - - - - - - - - - - - -  ~<u>Hello There</u>!~ - - - - - - - - - - - - - - - ✽</h3>

➷ It would be D. 25 degrees. This is because there was the highest oxygen  flow at this temperature meaning that the rate of photosynthesis was higher.

➶ Hope This Helps You!

➶ Good Luck (:

➶ Have A Great Day ^-^

↬ ʜᴀɴɴᴀʜ ♡

8 0
3 years ago
Read 2 more answers
HELP QUICK-Which of the following is true regarding the atoms involved in a chemical reaction?
NeTakaya

Answer:

The same number of each type of atom will always be present before and after a chemical reaction takes place.

Explanation:

8 0
3 years ago
Other questions:
  • for the freckles trait, having freckles (F) is dominant while no freckles (f) is recessive. What will someone that is Ff look li
    12·1 answer
  • In his experiment, Mendel used a monohybrid cross to __________. (Select all that apply.)
    10·1 answer
  • When plants wilt their soft stems and leaves begin to droop what is going on inside the plant cells that cause plants to droop l
    11·2 answers
  • Why does a butterfly look like the face of an owl?
    5·2 answers
  • Activators are proteins that bind to regions of DNA and increase the rate of transcription of specific genes. Repressors, on the
    7·1 answer
  • Which reason best explains why dead specimens must be used with transmission electron microscopes
    12·1 answer
  • The acids on the pH scale run from<br> 0-14<br> 1-100<br> 0-6<br> 8-14
    13·1 answer
  • The original sequence of DNA was ACT GGA GGG CAC but when the DNA was replicated an error
    9·1 answer
  • Which of the following is not a function of cell membrane
    8·1 answer
  • On Which ends is the phosphate group on a nucleotide
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!