1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
4 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]4 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
Which components of a galaxy move in circular patterns or revolve around a star? O Gas Dust Other orbiting objects O Sun​
Svetradugi [14.3K]

Answer:

Other orbiting objects

Explanation:

it is Other orbiting objects

8 0
3 years ago
A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?
Ivenika [448]

A cross-sectional view of a log shows a concentric pattern. Which part of the stem gives rise to this pattern?

B. Xylem

as it contribute for most of a tree's growth in diameter.

5 0
3 years ago
Protons have a positive charge, electrons have a negative charge, and neutrons have no change. Given
weqwewe [10]
B it needs to lose a neutron and a proton so that all parts of the atom are equal
7 0
3 years ago
A popular seedless vascular plant is _____.
Alina [70]
The fern is a popular seedless vascular plant.
Edward Jenner first "discovered" a vaccine for cowpox, which provided immunity for smallpox.
4 0
3 years ago
Read 2 more answers
A Jewish couple is about to be married but they both worry about their family history. The man's uncle and the women's aunt died
Snowcat [4.5K]

Answer:

A Jewish couple is about to be married but they both worry about their family history. The man's uncle and the women's aunt died of Tay Sachs disease. Infer why the couple is hiring a genetic counselor analyze their families pedigree.

Reasons are not far-fetched, both intended couple might carry a dominant gene for Tay Sachs disease or one of them has a dominant gene for such, it is pertinent a genetic counselor analyze their family pedegree in order to avoid having such disease or passing it to their offspring.

The chances of either of the intended couple to carry such dominant gene of the disease is imminent.

Explanation:

5 0
4 years ago
Other questions:
  • When an ecologist compares the diversity of different communities by counting the number of species within each community, the m
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which type of wave results from a moderately sloping coastal region?
    6·2 answers
  • Describe what a person in the passenger seat will feel as the car reaches point A
    8·1 answer
  • Which marine creature was thought to be extinct for 80 million years until one was caught off the coast of Madagascar in 1938?
    15·2 answers
  • What is the relationship between exergonic reactions, endergonic reactions and the use and regeneration of ATP?
    15·1 answer
  • Which of the following elements is NOT located in Period 3?
    5·2 answers
  • "While bird watching, Carl hypothesized he could identify 73 different types of birds in one day. He actually identified 65 diff
    15·1 answer
  • Why do a chicken embryo and a cow embryo look very similar even though the adults do not?
    6·2 answers
  • Can someone help me​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!