1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
I’m 34 years old. My mother and father are citizens of Russia. I have been a permanent resident in the U.S. for 3 years
vovangra [49]

Answer:

That's pretty cool

Explanation:

6 0
2 years ago
What is the cell cycle??
OLEGan [10]
The series of events that take place in a cell<span> leading to its division and duplication (replication) that produces two daughter cells. </span>
6 0
2 years ago
Read 2 more answers
If there is a 1-degree change, coral reefs will become______?
jek_recluse [69]

Answer:

warmer

Explanation:

6 0
3 years ago
Which atoms and/or ions expand in all directions?
GenaCL600 [577]

Gaseous atoms and plasmic ions expand in all directions.

7 0
3 years ago
Read 2 more answers
Suppose thymidine labeled with carbon-14 was added to a culture of bacteria and allowed to incubate for 20 minutes (one generati
Yanka [14]

Answer:

One strand of all the isolated DNA double helices would have C-14 labeled thymidine.

Explanation:

DNA replication is a semiconservative process which means that each newly formed DNA double helix contains one parental strand and one newly formed strand.

Since the medium has thymidine labeled with C-14, all the newly formed strands formed during DNA replication would have radio-labeled thymidine.

Therefore, by the end of 20 minutes, one out of two strands on each double helix would have labeled thymidine nucleotides.

3 0
3 years ago
Other questions:
  • In 1850 there was a large snowshoe rabbit
    5·1 answer
  • Which small piece of dna molecule contains no base pairing errors
    8·1 answer
  • In the equation used to calculate acceleration Vi stands for?
    9·1 answer
  • 1. **How does the amount of carbon the US emits compare to other countries?
    5·1 answer
  • Which three foods typically contain high amounts of monounsaturated fats?
    9·1 answer
  • Small pieces of the Earth’s crust that float on the liquid mantle are called
    6·1 answer
  • The phenomenon causing the greenhouse effect is that ________ in the lower atmosphere selectively absorbs reradiated ________ ra
    13·2 answers
  • Please select the word from the list that best fits the definition has constantly changing amount of salt in the water
    12·2 answers
  • Please help me with this question:)
    9·1 answer
  • Which of the following best explains why ptyalin is able to break down starches, but not protein?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!