1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
5

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Biology
1 answer:
Mariana [72]3 years ago
6 0

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

You might be interested in
In his theory of evolution, Charles Darwin was not able to explain
maks197457 [2]

Answer:

4 Charles Darwin was not able to explain the variation

8 0
3 years ago
According to the passage the bionic pancreas makes corrective actions that return blood sugar levels back to normal this artific
Georgia [21]
Maintain homeostasis
6 0
3 years ago
What do scientists often use to study microevolution?
Allisa [31]
They are known as evolutionary biologists. Strictly speaking, anthropology is split up into a number of disciplines - physical (sometimes known as biological) anthropology is the study of evolution as it relates to human beings. Further to this, scientists who study evolution in the fossil record are known as evolutionary palaeobiologists or simply palaeobiologists.
6 0
3 years ago
Read 2 more answers
List the sequence of events involved in the alternation of generations in land plants
Keith_Richards [23]
<span>The sequence of alternation of generation is; gametes->zygote->sporophyte->spores->gametophyte->gametes. The attached diagram shows clearly this looped cycle. Alternation of generation occurs in a more advanced land plant that has distinct haploid and diploid phases in their life cycle. The diploid phase usually involves the sporophyte while the haploid phase involves the gametophyte</span>




7 0
3 years ago
Plans look green because ? green light
bazaltina [42]
Plants look green because they absorb all light except the green one.

you can prove it as when you give plant green light only ....it will not produce...or produce a very little.....so the answer
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which factor was most responsible for the production of oxygen by the elodea? a the presence of light stimulated photosynthesis.
    6·1 answer
  • Fossils that contain the actual body parts or bodies of organisms are called ______. trace fossils original remains original fos
    13·2 answers
  • State your hypothesis (developed in step 8) here. be sure to include what you think the ph will be, and why. what is a neutraliz
    8·1 answer
  • During pregnancy, a cell undergoes what appears to be a normal mitotic nuclear division. However, two daughter cells with 2n-1 a
    14·1 answer
  • .Soil and plants are not considered nitrogen reservoirs true or false?
    5·2 answers
  • Scientist who studies the plant life in an environment
    14·2 answers
  • A decrease in cell-cell adhesion was caused by the introduction of an experimental substance that compromised the structural int
    8·1 answer
  • What is a Genome? Where is it found? What does it contain?
    9·1 answer
  • Can I get help please and thank you.
    14·2 answers
  • with reference to structural features describe how pollination occurs in a named insect pollinated flower​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!