1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
9

Heat released as the reaction occurs e. Heat stored within product molecules

Biology
1 answer:
Andreyy893 years ago
7 0

answer to question 7 - Tube 4: Amylase present, body temperature (37ºC)

answer to question 9 - Hydrogen bonds between water and another substance

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is the meaning of proactive
IRISSAK [1]
Creating or controlling a situation by causing something to happen rather than responding to it after it has happened.
3 0
3 years ago
Read 2 more answers
Some species of cuckoos lay their eggs in the nests of other birds. When the birds hatch, the other species tends to the cuckoo’
Yanka [14]

Answer:

The correct answer would be C) It increases survival for cuckoos, but decreases survival of the other birds.

The host chicks often face lots of competition from the cuckoo chicks in terms of food as well as space. It makes it difficult for the host chicks to survive.

It has also been found that cuckoo chicks beg to be fed more intensely due to which host chick die due to starvation.  

In addition, in some species of cuckoo, cuckoo chicks remove host eggs from the nest within few days of hatching.

6 0
3 years ago
Which is part of Charles Darwin's reasoning for evolution by natural
DedPeter [7]

Answer:

it will option C this is correct answer

6 0
3 years ago
When comparing dogs to wolves, scientists found evidence that supports the idea they come from a common ancestor. Which combinat
Scorpion4ik [409]

Answer:

when comparing dogs to wolves, scientists found evidence that supports the idea they come from a common ancestor. which evidence was most important in understanding this? comparable anatomies, fossils, and behavior different anatomies, similar development, and different dna comparable anatomies, similar development, and similar dna different anatomies, fossils, and behavior

Explanation:

4 0
2 years ago
Other questions:
  • Muscles are attached to bones by _____.<br> marrow<br> tendons<br> ligaments<br> skin
    9·2 answers
  • Which of these descriptions of the behavior of chromosomes during meiosis explains mendel's law of segregation?
    11·2 answers
  • In the oceans the colder water sinks into deep basins, while warmer water stays closer to the surface. The water then moves arou
    5·2 answers
  • A scientist investigated DNA replication in two groups of cells, labeled A and B. She injected radioactively labeled nucleotides
    13·1 answer
  • How are models used
    8·2 answers
  • On one of the compound microscopes in the lab, the diameter of the field of view at a total magnification of 100X was measured t
    9·1 answer
  • Which organelle in an animal cell would have the most water?
    13·2 answers
  • What causes scientist to disagree
    13·1 answer
  • What is meant by acropetal succesion?​
    7·1 answer
  • What are some possible future career fields in environmental science
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!