Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The acidity level of water is measured by the pH scale. Pure water has a pH of 7, which is neutral. However, natural rainwater actually has a pH of 5.6 because it gets exposed to the gases in the atmosphere, making it a bit acidic. True acid rain will have a pH level measuring from 5.0-5.5.
Answer:
It is similar because the nuclear envelope is a membrane similar to the cell membrane around the whole cell. There are pores and spaces for RNA and proteins to pass through while the nuclear envelope keeps all of the chromatin and nucleolus inside. When the cell is in a resting state there is something called chromatin in the nucleus.
Explanation:
Answer
I added 4 and 5 as an attachment due to time constraint.
Explanation:
1. at a steady state ca2+ taken by vesicle = 40n/mol
enclosed volume of CSR = 5μ/mg
concentration of ca2+ in vesicle =
40*10⁻⁶/5x10⁻⁶
= 0.008
= 8x10⁻⁹mol/L
2. radius of circle =75nM
volume = 150nm
volume of vesicle = 4/3 x pi x r³
= 1.33 x 3.14 x (75x10⁻⁹)³
= 1.77 x 10⁻²¹
when we convert this we get
1.77x10⁻¹⁸L since 1m³ is equal to 100oL
surface area =4x3.14x(75x10⁻⁹)²
= 12.56x5.625⁻¹⁵
= 7.065x10⁻¹⁴m²
this is 7.065x10⁻¹⁰cm²
3. number of vesicle/CSR
= 5x10⁻⁶/1.77x10⁻¹⁸
= 2.824x10¹²
surface are = 2.824x10¹² x7.06x10⁻¹⁰
= 19.95x10²
