1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
8

What type of environment is likely to be found on the side of a mountain range opposite the direction of the wind?

Biology
2 answers:
REY [17]3 years ago
7 0

Answer:

It is B.) desert

Explanation:

A desert is often found on the eastern side of mountain ranges in the United States. This is because as clouds climb over the mountain range, the usually lose much of their moisture, and little rain can then fall on that side.

babymother [125]3 years ago
6 0
A because tundra means dry also
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
HELP ASAP! In what direction does air fow between areas of high and low pressure?
Anna71 [15]

Answer:

Explanation:

winds blow clockwise around an area of high pressure and counter-clockwise around low pressure.

7 0
3 years ago
Where are the instructions for cell differentiation located?
docker41 [41]
In DNA, which is located in the nucleus of the cell
5 0
3 years ago
Read 2 more answers
Summarize how the functions of organelles in animal cells and plant cells are the same and different.
Alex_Xolod [135]
<span>Plant and animal cells have different structures. One structural difference of plant cells and animal cells is the presence of the plant cell’s </span>cell wall,<span> specialized plastids and a large central vacuole which are not found within animal cells.

Another difference is the garbage disposal of each cell. Centrosomes and lysosomes are found in animal cells but both do not exist within plant cells. The animal cell’s garbage disposal takes place in the lysosome while garbage disposal of plant cells takes place in the vacuole.</span>
3 0
3 years ago
PLZ ANSWER QUICKLY ALSO THIS QUESTION IS FOR SCIENCE
Juli2301 [7.4K]

Answer:

Warm air rises, creating a low pressure zone; cool air sinks, creating a high pressure zone.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Laboratory techniques for randomly linking together amino acids typically generate an insoluble polypeptide, yet a naturally occ
    13·1 answer
  • What are the consequences of abundant populations of feral pig
    8·1 answer
  • Which homeostatic process requires energy to move particles across the plasma membrane?
    7·1 answer
  • A number(b) increased by 15 is 3.
    6·1 answer
  • Mutations that neither benefit nor harm the organism have effect on the organism's survival.
    5·2 answers
  • A turtle laying in the sun to maintain its body temperature
    8·1 answer
  • Rock A snd B are loxated at the same height ob top of a hill. The mass of rock A is twice the mass of rock B. How does the ptent
    9·2 answers
  • We have learned to:
    8·2 answers
  • The cell is most active mitotically in the g phase
    11·1 answer
  • What are the three main functions of the cardiovascular system?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!