1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksivusya [100]
3 years ago
6

Which of the following statements are true?

Biology
1 answer:
Goshia [24]3 years ago
3 0
B! we had to alter them to our preferred taste and nutrients
You might be interested in
Pressure-sensitive hair cells are the receptors for which sense?
Vitek1552 [10]
The sense of touch :)
8 0
3 years ago
Read 2 more answers
What are three characteristics of equisetophyta ​
Airida [17]

Ive nevr heard of that

4 0
4 years ago
PLS HELP questions are in the picture!!
Vesna [10]

i got youu

Answer:

This picture is modeling how animals get nutrients and how it looks. If you look in the photo, you can see many animals and arrows pointing at one another, This shows animals fighting each other. An example would be the girafee, If you look closley the photo is showing the girafee getting nutrients from the tree. This shows the girafee getting the organisms it needs in order to survive.

7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Please help me!!!
Agata [3.3K]
It's C. RNA uses Uracil in place of Thymine

<span>TGCAAT
</span><span>ACGUUA</span>
5 0
4 years ago
Read 2 more answers
Other questions:
  • At what point does high blood sugar cause damage
    14·1 answer
  • Genetically-modified organisms (GMOs) have included corn crops engineered to produce a natural pesticide to kill a certain insec
    9·1 answer
  • How do gene interactions affect gene expression?
    5·1 answer
  • Evaporative cooling is a product of evolution that has evolved in some organisms for use under certain environmental conditions.
    7·1 answer
  • What responses it takes to open or close ion channels
    5·1 answer
  • 5. Which of the rock samples below is most likely to be a metamorphic rock?
    8·2 answers
  • Table salt and water are examples of?
    9·1 answer
  • Identify three environmental influences on microbial growth. How does each affect microbial distribution?
    7·1 answer
  • Which of the following organisms would usually compete with mice for seeds to eat in an ecosystem?
    15·1 answer
  • Is a coconut a vegetable or fruit?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!