Answer:
They have uncoiled to form long, thin strands.
Explanation:
Chromosomes are present in cell nucleus and consist of chromatin. Genes are present in linear order on chromosomes. The chromosomes become visible under the microscope as distinct structures during cell division. When cells are not dividing, the chromosomes decondense to loose their individuality and make the mass of chromatin.
Chromatin is complex of DNA and packing proteins. As the cells enter the prophase stage of cell division, condensation of chromatin occurs and individual chromosomes become visible under microscope. Before that (during interphase), chromosomes are not visible as they are present in decondensed form.
A life expectancy of 2 to 5 years less than peers.
I’m sorry if you don’t want me to go take a break off
If Alpa wants to change 0.54 kilometers into a smaller metric unit, she will be required to multiply.
<h3>What is a Metric unit?</h3>
A Metric unit may be defined as a technique of measurement in which the basic units are the meter, the second, and the kilogram. These units are interchanged with one another by using several formulas of conversion.
The complete question is as follows:
Alpha wants to change 0.54 kilometers into a smaller metric unit. She will have to:
- multiply
- divide
- add
- subtract
Therefore, If Alpa wants to change 0.54 kilometers into a smaller metric unit, she will be required to multiply.
For example, In case, if she wants to convert 0.54 into meters, then she has to multiply it by 1000, that is, 0.54 * 1000 = 540 meters.
To learn more about Metric units, refer to the link:
brainly.com/question/1576704
#SPJ1
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
