1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
10

A rock climber climbs up the rock wall how do the bones and muscles in his arms interact to allow him to climb up

Biology
1 answer:
Svetllana [295]3 years ago
7 0
The muscles pull the climber up, and the bones support those muscles. much like Window cleaners on scaffolding
You might be interested in
What role does the overproduction of organisms play in natural selection?
Nonamiya [84]
They could look for similarities in the DNA or protein structuresof the organisms<span> and similarities in early development</span>
6 0
2 years ago
The amount of matter per unit volume is called
Scrat [10]

density, it's a mass per unit volume

8 0
2 years ago
Why is Acinetobacter bamannii bacteria dangerous.
shepuryov [24]
Because it can cause serious infections in the lungs, blood and our brains...It may also cause urinary tract and infections in wounds.
8 0
3 years ago
Read 2 more answers
(AKS 4c/DOK 1) Which of the following BEST explains what would happen to animal cells if plant cells did NOT perform photosynthe
guapka [62]

Answer:

anizat2sweet,sorry gsw

4 0
3 years ago
What process is carried out when bacteria converts milk into yogurt
Svetlanka [38]
Lactic Acif Fermentation
8 0
3 years ago
Other questions:
  • The shoes traveled faster than the rubber ducks and the bath toys. Propose a hypothesis to explain why the shoes traveled faster
    9·1 answer
  • What human activity destroys the most natural animal habitats
    6·2 answers
  • A sonic boom is produced by a jet. What can you determine about the jet's motion?
    10·2 answers
  • Advertisers' attempts to "break through the clutter" usually result in
    13·1 answer
  • What are the large claws on crustaceans called?
    11·1 answer
  • An amoeba eats some food. Which organelles will help store and digest it? vacuoles and lysosomes mitochondria and ribosome endop
    10·1 answer
  • Match the phases in the cell cycle to the events that occur in each phase.
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In a cup of liquid water when will the water molecules start moving
    10·2 answers
  • Can someone please help me? (Natural Selection Lab! Light-colored moths &amp; dark-colored moths)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!