1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
statuscvo [17]
3 years ago
5

What is the likely explanation for the rapid increase in body and brain size among homo erectus?

Biology
1 answer:
grandymaker [24]3 years ago
7 0
The rapid increase in body and brain of the homo erectus before was because of the irregularity of the Earths climate. The large brain of the homo erectus gave them a big advantage in learning new things to adapt to the changing environment.
You might be interested in
Which force is responsible for waves and surface currents?
Fynjy0 [20]
Ocean tides are caused by the gravitation of the Moon. Currents can be formed by the flow of tidal water around the continental plates, or by a difference in water temperature between large ocean areas. Surface waves are caused by the wind. Abnormal waves can be created by the tectonic movement of plates around and under the ocean floor (tsunamis). So as you can see, the answer is (C) Gravity

* PLZ Mark my answer as Brainliest. I need them. Plz and thanks
3 0
4 years ago
Oh, no... you dropped your study flashcards, and now they're out of order! Put them back into the correct order for a eukaryotic
Vladimir79 [104]

The given question is incomplete, the complete question is:

Oh, no... you dropped your study flashcards, and now they're out of order! Put them back into the correct order for a eukaryotic cell.

a.  "Combine the mRNA strand with a ribosome and a tRNA carrying a methionine."

b. "Unwind the DNA molecule near the promoter."

c. "Exit the nucleus to the cytoplasm."

d. "Transcribe the complementary RNA strand."

[Tip: you might want to work out the correct order on a piece of scratch paper before selecting from the options below.]

c - d - b - a

b - d - c - a

c - b - d - a

d - b - c - a

b - d - a - c

Answer:

The correct order would be b, d, c, a.

Explanation:

First unwinding of the molecule of DNA takes place close to the promoter. After that transcription of the complementary RNA strand takes place, then mRNA moves out of the nucleus into the cytoplasm. Ultimately, the combination of ribosome and tRNA carrying a methionine takes place with the mRNA.  

The order is based upon the central dogma of the cell. Based on the central dogma concept, the transcription of the mRNA takes place in the first place, which then gets transported out of the nucleus into the cytoplasm in the eukaryotic cell. The unwinding of DNA takes place close to the sequence of the promoter for the process of transcription.  

In the promoter region, various transcription factors are present and binding of RNA polymerase takes place with the template strand. The generated mRNA then get transported out of the nucleus into the cytoplasm. Post transcription, translation of mRNA takes place with the assistance of tRNA and ribosome. In the mRNA, the start codon generally codes for methionine because of which the tRNA that carries methionine identifies the start codon, and the process of translation gets initiated.  

5 0
3 years ago
The _____ produces secondary phloem and xylem tissue, adding to a tree's girth.
lilavasa [31]
The aswer is b. Vascular Cambium

it is a plant tissue which is located between Xylem and Phloem in the stem and root of a vascular plant and the source that produces Secondary xlem and phloem

Nb : Vascular Cambium does not transport waters , minerals, it only produce Xylem and Phloem which add the tree's girth
7 0
4 years ago
MtDNA is transferred along material lineage
lorasvet [3.4K]

Answer:

True

Explanation:

mtDNA is passed from mother to child.

5 0
3 years ago
Read 2 more answers
Scientific ____ must be supported by observations and results from many investigations and are not absolute.
azamat
Scientific methods must be supported by observations and results from many investigations and are not absolute.
3 0
3 years ago
Other questions:
  • Qual a importância da epiglote no processo de ingestão
    10·1 answer
  • Is thermal energy being transferred by radiation in this image? Why or why not?
    13·2 answers
  • Panic grass (Dichanthelium lanuginosum) can live in geothermally heated soils only when the fungus Curvularia protuberata is pre
    15·1 answer
  • Which statement about green plants is true?
    15·2 answers
  • True or False. The more threads a screw has the greater the holding power of the screw.
    10·2 answers
  • A fictional* element has 12 neutrons, and 31 protons, and 31 electrons. What is its atomic mass? Write just the number, no units
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • In 1990, Carl Woese introduced the three-domain system for classifying living things, after the advancement of DNA analysis allo
    10·1 answer
  • For APEX A mitochondrion cannot produce new molecules. Which structure is most
    9·2 answers
  • If a change in the soil occurred, how could that impact the organisms (consumers) in that ecosystem? Pls explain
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!