1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jobisdone [24]
2 years ago
6

A unit of length in the metric system is the A-kilogram B-kilometer C- liter

Biology
2 answers:
insens350 [35]2 years ago
8 0

Your answer is kilometer I hope you have a wonderful day

--- Joseph

babunello [35]2 years ago
4 0
Remember that measuring length is a measure of distance. Let's check our answers for any pending measures of distance.

Kilogram.
Kilogram is a measure of mass (or weight). This can normally be used for example for the SI Unit symbol: Kg.

We can get rid of kilogram, since it does not measure distance.

Kilometer.
Kilometer is a measure of distance. This can normally be used for example by it's SI Unit symbol: KM.
Kilometer can be broken down by it's prefix.
Kilo = Thousand

Kilometer means 1,000 meters, which is a unit of distance/length.

Your answer is B.) Kilometer.

I hope this helps!
You might be interested in
Tell the difference between qualitative and quantitative data? Give two examples for each.
Yanka [14]

Answer:

Qualitative data is based on the quality of something an example can be the quality of a camera.

Quantitative data is based on quantity (numbers) an example can be the number of students at a football game

HOPE IT HELPED!! Please give it the best answer.

Explanation:

3 0
2 years ago
In ecosystems, plants transform light energy from the Sun into chemical energy when they make sugar. This sugar can then be cons
pav-90 [236]
The answer is D matter and energy shown in the question can change forms and is transferred to other locations for organisms to be used as building blocks for others.<span />
3 0
2 years ago
Read 2 more answers
Which means of particle transport requires energy from the cell
Goryan [66]

Answer:

Active transport requires energy input from the cell.

3 0
2 years ago
The molecules in plant cells that absorb light energy are called
miskamm [114]

Pigment....

..........

4 0
2 years ago
What are the risks linked to dehydration
Alenkinab [10]
If the body loses a substantial amount of fluids and salts and they are not quickly replaced; for example: by drinking, the body starts to "dry up" or get dehydrated. Severe dehydration can cause death. The usual causes of dehydration are a lot of diarrhoea and vomiting
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following do not have organelles? A) Muscle B) Protozoa C) Nerve Cells D) Bacteria
    12·2 answers
  • It’s is the nature of living organisms to give birth to offspring before they die. What are the two methods used by living organ
    6·1 answer
  • A large water filled organelle present in all plant and fungal cells and some animal and bacterial cells
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Amy was observing the growth of five kinds of flowering plants on a windowsill. She noticed that some of the flowers
    9·1 answer
  • Pioneer organisms are the first organisms to reoccupy an area. True or False
    13·1 answer
  • Someone please answer I really need help!
    6·2 answers
  • What cause Indiana climate change?​
    5·2 answers
  • Evaporation, _________, and precipitation are the three main stages of the water cycle A) hydration B) Condensation HELP!!!!!
    6·1 answer
  • You want to artificially increase function of the dopamine system in one or more regions of the rat brain. Which of the followin
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!