1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pochemuha
4 years ago
8

Fill in the Punnett square for a cross between the following individuals.

Biology
2 answers:
Neko [114]4 years ago
5 0

Stole the image from the question directly above yours.  50% of the offspring are heterozygous (Aa) and red.  The other 50% are homozygous recessive (aa) and white.

MaRussiya [10]4 years ago
4 0

Answer:

50% of the offspring will have the "Aa" alleles and for this reason they will have the dominant, red characteristic.

50% of the offspring will have the "aa" alleles and for this reason, they will have a white, recessive characteristic.

Explanation:

The punnet square shown in the question above is filled in the figure attached below. In it, we can see that the cross between a living being with the "Aa" alleles and a living being with the "aa" alleles would result in 50% "Aa" and 50% "aa" offspring. Those who have the dominant allele "A" will have a dominant characteristic of red color, while those who do not have the dominant allele, will have a recessive characteristic of white.

You might be interested in
How does the primary transcript in the nucleus of a eukaryotic cell compare to the functional mrna?
Brrunno [24]
The primary transcript in the nucleus of a eukaryotic cell is a messenger RNA but it is not yet functional. There will still be non-coding parts of the mRNA that needs to be removed (introns) and then coding parts must be spliced together (exons). After which, there is capping of the mRNA (5' or 5 prime capping) with <span>7-methylguanylate. There will also be adding multiple adenine residues in the 3' end of the mRNA called polyadenylation resulting to a poly-A tail at the 3' end of the mRNA. mRNA with spliced exons, a 5' cap, and a poly-A tail is now a functional RNA.</span>
4 0
3 years ago
Hannah bought a potted rose plant. She’s looking for a place to put it. Where is the rose plant most likely to thrive?
exis [7]
By a window? I don't know if you have multiple choice on the question but she should put it where there is sunlight.
7 0
4 years ago
Read 2 more answers
What would you do if you turned into a pickle?
zimovet [89]
Dead. Pickles don’t have brains
7 0
3 years ago
Read 2 more answers
With the exception of discovering new microbes, does it make sense to believe that the current taxonomic organization of microbe
Tasya [4]

Answer:

Recent advancement in genetic engineering  is unraveling genetic sequences to provide in-depth   understanding of the study of interrelationship among different organisms. Most of this research studies are still in early stages, therefore the current taxonomic organization will still change.

Furthermore; new techniques are being developed every day for understanding and analysis of these interrelationships among different organism, thus the dynamism of this classification is certain.

7 0
3 years ago
How would life on Earth be affected if water was less dense than ice?
Veseljchak [2.6K]

Answer:

freeze and sink over and over until the entire lake was frozen.

Explanation:

This would eliminate many aquatic organisms and produce a system with far fewer life forms in lakes which freeze periodically.

6 0
3 years ago
Other questions:
  • Suchita makes a table to identify the variables used in the equations for centripetal force.
    8·2 answers
  • Oxygen-rich blood is carried to the brain via the
    11·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • One difference between carbohydrates and lipids is that
    5·2 answers
  • Where is caulerpa native
    5·1 answer
  • Select the correct answer.
    8·1 answer
  • It is impossible for sperm to be functional (able to fertilize the egg) until after ________. Group of answer choices
    5·1 answer
  • What determines the function??
    6·1 answer
  • YO PLZZ HELP!!!!!
    13·2 answers
  • How do HABs affect each ocean zone?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!