1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mice21 [21]
2 years ago
9

A nurse is planning to provide instructions to the client about how to stand on crutches. in the instructions, the nurse plans t

o tell the client to place the crutches select one:
a. 8 inches to the front and side of the clients toes

b. 15 inches to the front and side of the clients toes

c. 20 inches to the front and side of the clients toes

d. 3 inches to the front and side of the clients toes
Biology
1 answer:
bazaltina [42]2 years ago
8 0
20 inches to the front and side of the clients toes
You might be interested in
Score 5
irina [24]

Answer:

In medicine, genetic engineering has been used to mass-produce insulin, human growth hormones, follistim (for treating infertility), human albumin, monoclonal antibodies, antihemophilic factors, vaccines, and many other drugs. In research, organisms are genetically engineered to discover the functions of certain genes.

Explanation:

8 0
2 years ago
Read 2 more answers
Is the earth flat or round?
Naddik [55]

Answer: the Earth is round.

Explanation:

4 0
2 years ago
Read 2 more answers
Which of the items listed below are consider charateristics of living only? (Choose 3)
LenaWriter [7]
All living things have cellular organization
5 0
2 years ago
proteins are made by combining the building blocks called ------------- through a process called ---------- ------------.
Reptile [31]
Codons or Amino Acids. Translation. 
5 0
2 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • The circulatory system removes waste products from:
    9·2 answers
  • Nodules containing nitrogen-fixing bacteria would be expected to occur on the roots of
    8·1 answer
  • Erwin Chargaff observed that the proportions of adenine (A) and thymine (T) bases were always equal, as were the proportion of g
    11·1 answer
  • What is the period of cell life when it is conducting cell division?
    7·2 answers
  • What , measurement unit represents volume?
    9·1 answer
  • A clownfish protects the sea anemone from being attacked. The clownfish hides within the sea anemone for protection. This is an
    9·1 answer
  • Plant Cell
    12·1 answer
  • 21. What does “opt out” mean with regards to Europe’s organ donation policy?
    7·2 answers
  • Help meee plsss I wanna cry
    7·1 answer
  • How long can you keep a fresh turkey in the refrigerator?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!