1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Grace [21]
3 years ago
6

Help Please I don't get this

Biology
1 answer:
VMariaS [17]3 years ago
3 0
What kinda cell, animal or plant?

You might be interested in
The elbow is an example of which type of joint?<br><br> hinge<br> pivot<br> saddle<br> gliding
Lubov Fominskaja [6]
The elbow is an example of a hinge joint
7 0
3 years ago
The makeup of all the different species in the world is
Lerok [7]
Biological diversity...
7 0
3 years ago
Two organisms that adapt in a way that<br> meets each other's needs is a demonstration<br> of ___
zzz [600]

Answer: survival

Explanation:

8 0
3 years ago
Types of calcareous marine microorganisms
Anon25 [30]
The types of the calcareous marine microorganisms includes the following: fungi,algae,protozoa and bacteria.
5 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Other questions:
  • What organ is the major site for gluconeogenesis (making glucose)?
    14·1 answer
  • You have a sealed glass jar full of air. If you put it in the freezer, what happens to the gas pressure in the jar?
    13·1 answer
  • Enchanted Rock State Natural Area is located in Central Texas. Enchanted Rock is a dome of granite. The area contains four easil
    8·1 answer
  • What is the sequence of the complementary strand of DNA to this strand? A-T-G-A-T-C-T-C-G-T-A-A
    8·1 answer
  • Canadian winters can be particularly harsh. Describe two adaptations of stems that help plants survive Canadian winters.
    10·1 answer
  • What is in only animal cells​
    8·1 answer
  • 31,645 centimeters to meters
    5·1 answer
  • How does the occurrence of mutation impact biodiversity?
    13·2 answers
  • What make the si system better than the english system of measurement?
    9·2 answers
  • Which is a main function of lipids?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!