1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
4 years ago
15

A membrane that allows only some materials to move in and out of the cell is

Biology
1 answer:
-Dominant- [34]4 years ago
4 0

Answer:

semipermeable

Explanation:

semipermeable membrane, such as plasma membrane, only allows only some materials such as oxygen—small material. other <em>stuff</em><em> </em>like starch couldn't get in.

You might be interested in
Which best describes oxidation-reduction reactions?
larisa86 [58]

option-A if there is a change in the oxidation states of atoms from reactants to products, the reaction in an oxidation reduction reaction describes the oxidation-reduction .

We know that oxidation is a process that increases the oxidation number, whereas reduction is a process that decreases the oxidation number. An oxidation-reduction (redox) is a type of chemical reaction wherein the electrons are exchanged among distinct strains Any chain reaction that occurs when the oxidation number of the a molecule, atom, or ion modifications by acquiring or losing an electron is an oxidation-reduction reaction. Reduction-oxidation reaction any chemical reaction in which one species oxidizes (loses electrons) while another species reduces (gains electrons) Oxidized. defines an element that has lost electrons and increased its oxidation number

Learn more about oxidation-reduction here:

brainly.com/question/28216195

#SPJ4

the complete question is:

Which best describes oxidation-reduction reactions?

A- if there is a change in the oxidation states of atoms from reactants to products, the reaction in an oxidation reduction reaction

B-If there is formation of salt and water, the reaction is an oxidation-reduction reaction.

C-If there is formation of a precipitate, the reaction is an oxidation-reduction reaction.

D-If there is no change in the oxidation states of atoms from reactants to products, the reaction is an oxidation-reduction reaction.

4 0
1 year ago
A transform boundary occurs where two tectonic plates _____.
wariber [46]
A transform boundary occurs where two tectonic plates grind along each other.

hope the answer helped you.
4 0
3 years ago
Read 2 more answers
Coastal urbanization does not increase the risk to human communities from which of the following natural disasters?
True [87]
The answer is a.Earthquakes
7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
How much of the ocean has been explored
Mnenie [13.5K]

Answer:

Approximately five percent of the ocean has been discovered, which leaves 95 of the ocean unexplored. Depending on who you ask, there exists not one—but two—final frontiers of discovery.

5 0
3 years ago
Other questions:
  • Mr. Miller's biology class is studying cellular respiration. To model cellular respiration, they set up an experiment containing
    9·2 answers
  • Which ones are from a hurricane?
    14·1 answer
  • Which part of a cell allows nutrients and other materials to enter or leave the cell? A. chloroplast B. cytoplasm C. nucleus D.
    14·2 answers
  • The end of the ordovician period was signaled by
    12·1 answer
  • Explain why humans are a system of systems. Provide at least one example in your explanation.
    5·1 answer
  • Without spores, fungi could not:
    6·1 answer
  • How are all non-living things alike?
    6·2 answers
  • Freshwater biomes have
    13·1 answer
  • Which of the following provides the foundation for life on earth?
    6·1 answer
  • the study of how genes are transferred from parents to their children and the role of genes in health and disease is known as:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!