1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
7

Using blood doping to artificially increase the number of red blood cells in an athlete might lead to a long term shortage of re

d blood cells because
1) red blood cells could stop being produced by meiosis
2) homeostasis could be disrupted in the athlete
3) red blood cells could attack and destroy the extra red blood cells
4) the athlete would no longer need red blood cells
Biology
1 answer:
Zarrin [17]3 years ago
4 0

Answer:

Homeostasis could be disrupted in the athlete

You might be interested in
Dead animal matter lead to the formation of coal. question 1 options: <br> a. True <br> b. False
kicyunya [14]
I would say false because fossil fuels are formed by dead animal matter
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Hemoglobin consists of four globular proteins, each formed from a polypeptide chain. Each globular protein contains a nonprotein
ivanzaharov [21]

Answer:

d

Explanation:

4 0
4 years ago
Help with question 3 please (:
tangare [24]
I’m not sure but I think DNA
6 0
3 years ago
9. People with AIDS are unable to fight multiple infections because the virus that causes AIDS
Rina8888 [55]

Answer:

I think it is (1)

Explanation:

Please give me brainliest :)

4 0
3 years ago
Read 2 more answers
Other questions:
  • What are two possible uses of genetic engineering
    13·1 answer
  • PLEASE HELP!!!!!
    8·1 answer
  • Deleted question.........
    9·1 answer
  • Reynaldo is usually good-natured and fun-loving. Women enjoy his warmth and sense of humor. After a number of drinks, he becomes
    12·1 answer
  • Reputake means that:
    9·1 answer
  • Which statement is true for some photosynthesizing animals?
    15·2 answers
  • List 3 <br>danger of lack of TAP?​
    12·1 answer
  • How can you demonstrate that plant prepare their own food on its leaves ? write with experiment​
    6·1 answer
  • What would happen if u place a cell in a container of water with high solute concentration?
    6·1 answer
  • 9. What would need to change in order for the organism population in the example to continue
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!