1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GrogVix [38]
3 years ago
9

1. The model shows water molecules

Biology
1 answer:
kari74 [83]3 years ago
3 0

Answer:

Oxygen atoms in water molecules are also attracted to hydrogen atoms in other water molecules.

Explanation:

If you are referring to the picture attached and the choices given:

  • Hydrogen atoms in water molecules are only attracted to other hydrogen atoms.
  • Oxygen atoms in water molecules are attracted to both oxygen atoms and hydrogen atoms.
  • Oxygen atoms in water molecules are also attracted to hydrogen atoms in other water molecules.
  • Hydrogen atoms in water molecules are only attracted to an oxygen atom in the same water molecules.

What you can see there is what we call hydrogen bonding. The oxygen atoms are attracting the hydrogen of other water molecules. This type of bond forms in liquid water. Oxygen atoms of a water molecule are kind of negatively charged and can attract the partially positively charged hydrogen atoms of other water molecules.

You might be interested in
What can cause changes in the traits of a population?
Oksana_A [137]
Interracial mixing or breeding

Mutations or physical and mental disorders

environment- pollution, predatorism,

society- norms regulations laws

religion- beliefs morals ethics

Please vote my answer branliest! Thanks.
7 0
4 years ago
The macronutrients that we consume are broken down through digestion and then absorbed in order to ultimately. True or False
EastWind [94]

The question is incomplete as it is incomplete therefore a picture of the complete question has been attached.

Answer:

To be used by the cells for energy

Explanation:

The digestive process of humans digest or breakdown or oxidise the organic molecules present in the food to simple compounds which could be easily utilised by the human body.

The human body composed of tissue and cell requires energy to perform metabolic reactions in the form of ATP which are provided by the digestion of the complex food material.

The macronutrients present in the food thus are digested and absorbed by the cells to perform reactions which could provide energy therefore the selected option is the correct answer.

7 0
3 years ago
Which statement most accurately describes the composition of elements dissolved in sea water?
pickupchik [31]
The answer would be the letter b
5 0
3 years ago
Read 2 more answers
Describe the muscle feature that is being used in each naming scenario. for example, you have probably figured out that trapeziu
maw [93]

1.Gluteus maximus and Gluteus minimus

This muscles are classified by their size. Maximus means the largest of the group, which is correct because the others are small and medium sized). Gluteus minimus is the smallest of the group.

2.Frontalis and Temporalis

The frontalis and the temporalis muscles are classified by their location. Frontalis is front of the frontal bone of the skull; It serves for facial expressions, raising eybrows.

Temporalis is located on top of the temporal bone of the skull; Is able to move the tmandible.

3. Orbicularis Oculi and Transverse abdominis:

These muscles are far away from each other but they were named based on the same feature: the direction of fibers.

Orbicularis is because their fibers form a circle.
Transverse because crosses or 'traverses' the abdomen

4.Flexor Carpi Ulnaris and Extensor digitorum longus

These muscles are classified by what they do- their action.

Flexor carpi ulnaris flexes the hand at the wrist while the extensor digitorium longus extends the foot and toes upward.

5. Sternocleidomastoid and Brachioradialis

These muscles are named based on their origin and insertion.

Sternocleidomastoid has two origins, one in the sternum and the other in the collare bone (clavicle). It's insertions is in the mastoid process of the temporal bone.

Brachioradialis has an origin on the brachium of the humerus and it's insertion  is on the radius.

6. Biceps Brachii and Triceps Brachii

These muscles, with opposite functions, are named based on their number of origins.

Biceps brachii has two origins on the scapula that join to form a single muscle which is attached to the forearm

Triceps brachii has three origins on the humerus and joint to form one single muscle that attaches to the ulna.


3 0
3 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Other questions:
  • What is the fitness advantage for the angiosperm approach to the formation of nutritive tissue?
    7·1 answer
  • A forest has two groups of plants that appear to be very similar both phenotypically and genotypically. The major difference is
    9·1 answer
  • Expain why or why not the renaissance was or wasnt a thing.
    10·1 answer
  • These are tru or clase questions
    13·1 answer
  • What is embedded in the phospholipid bilayer?<br> help please
    10·1 answer
  • Why might certain areas in the US have more seismic activity than others
    5·1 answer
  • Which mutation below would result in the greatest amount of change in the proteins that code for a particular trait?
    9·1 answer
  • The release of ________ to muscle cell receptors triggers muscle contractions.
    9·1 answer
  • Which statement correctly describes the difference between cellular respiration and photosynthesis?
    13·1 answer
  • Plant and animal cells isolate from their environment in order to process nutrients.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!