Answer:I'm doing this right now and have no clue sorry ;-;
Explanation:
Answer:
Both perform photosynthesis.
Explanation:
Both perform photosynthesis led researchers to propose that Chloroplast evolved from Cyanobacteria.
Chloroplast is a organelle that contain the green pigment called chlorophyii which perform photosynthesis. This is found in both plant cell and algae cell. This trap light energy from sunlight and uses carbondioxide with water to produce sugar.
Cyanobacteria are known to be the ancestor of chloroplast and they are also refer to as blue green algae because they contain chlorophyii which is a photosynthetic pigment. The Cyanobacteria are able to perform photosynthesis because of chlorophyii which trap light energy from sunlight and uses carbondioxide and water to produce energy.
C acceleration describes how displacement changes with time
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.
