1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
11

Which factors caused the rapid decline or decrease of the Sierra Nevada yellow-legged frog population? Check all that apply. fis

h fungus pesticides UV radiation pollution
Biology
2 answers:
Otrada [13]3 years ago
8 0

Answer:

A. Fish

B. Fungus

Explanation:

Just did it on edge

trasher [3.6K]3 years ago
8 0

Answer:

fish and fungus

Explanation:

i took the lesson on edg 2020

You might be interested in
PLEASE HELP SOMEONE!!!!!!! first person to get it right gets brainliest
andreev551 [17]
B- yeast is used for baking things, it helps the dough rise in bread and pizzas etc
5 0
3 years ago
4. What is the carrying capacity of Wildebeest in the Serengeti?
Viefleur [7K]

Answer:

1,300,000

Explanation:

Explain that this limit is called the carrying capacity, and that it is the largest population size that the environment can support in the long run.

6 0
2 years ago
PLEASE REPLY QUICKLY
Tcecarenko [31]

Answer:

B. Only from the ocean to earth's surface

Explanation:

The biosphere is known as the layer of the Earth where life exists. It reaches a peak of ten kilometers above sea level, which is used by some birds in flight while the biosphere go to depths as low as 8 kilometers deep or the bottom of the ocean.

Hope this Helps!

8 0
3 years ago
Which statement is true?
marysya [2.9K]

Answer:

A) diploid cells contain two sets of chromosomes

4 0
2 years ago
Read 2 more answers
A mouse runs 2 metres in 4 seconds. What is its speed?
gavmur [86]

Answer:

0.5 m/s

Explanation:

V = m / t = 2 / 4 = 0.5 m/s

5 0
2 years ago
Other questions:
  • The _____ is sometimes referred to as the "master gland" because almost all of its hormones direct the activity of target glands
    8·2 answers
  • What percent of road collisions occur because of mechanical failures?
    11·1 answer
  • According to the lab safety sheet, which of the following is a potential hazard that will be present in the lab room during the
    8·1 answer
  • Your 1 st section should be about reproduction in humans.
    15·1 answer
  • A secondary consumer eats
    12·1 answer
  • what would happen if a mutation caused a stop codon to appear too early in the mRNA strain being translated by the ribosome?
    6·1 answer
  • Which organism needs care from its parents after birth? A. frog B. turtle C. mouse D. snake
    8·1 answer
  • Please answer!
    12·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What tests can be used to diagnose phenylketonuria?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!