1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
7

How many vertebrae are in the lumbar spine

Biology
1 answer:
RSB [31]3 years ago
8 0

Answer: 7

Explanation:

You might be interested in
Characteristics common to plants and animals regarding growth and reproduction are ______. (can be more than one answer)
lidiya [134]

evolution, and interdependence.

3 0
3 years ago
Read 2 more answers
The large deposit of sand and soil formed at the end of a river is a
Karolina [17]
A large deposit of sand and soil formed at the end of a river is a delta. When a river empties into the ocean, the current carrying smaller particles, such as soil and sand, slows down and eventually stops, causing these particles to be dropped off on the shore. This eventually leads to a triangular deposit, usually referred to as the mouth of the river.
6 0
3 years ago
Which solution is hypertonic?
Anna35 [415]

Answer:

injininijnjinijni

Explanation:

8 0
3 years ago
Read 2 more answers
Many different host factors can influence a person’s susceptibility or resistance to infectious disease. Some factors are associ
leonid [27]
4,2,1,3 hope this helps
7 0
2 years ago
What is 98% water and 2% salt inside the cell
otez555 [7]
Osmosis is 98% water and 2% salt inside the cell. 
6 0
3 years ago
Other questions:
  • Which provides the master code needed for protein synthesis?<br> Dna<br> Rna<br> mRNA<br> tRNA
    11·2 answers
  • Mendel’s law of segregation states that
    13·1 answer
  • Japan is the leading producer of farm-raised shrimp, offering a lower price than Americans who farm or catch shrimp for a living
    8·1 answer
  • Treponema and Borrelia A. are luminescent.B. are endosymbionts.C. are spirochaetes.D. are both easily grown on artificial media.
    11·1 answer
  • Chronic exposure to nicotine desensitizes _______ receptors in the midbrain.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • TRUE OR FALSE PLEASE HELP ME WITH THIS
    14·2 answers
  • When cells perform photosynthesis, they transform energy from one form to another. Which of the following takes place during pho
    6·2 answers
  • What process allows other scientists to replicate an experiment?
    15·2 answers
  • Energy plus matter is sufficient for continued development of order, complexity or growth.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!