Answer:
It would be B
Explanation:
By doing the punnet square, you get BB, BB ,Bb, Bb, of which 50% are heterozygous.
Answer:
I chose nucleus and the mitochondria
Explanation:
The nucleus is particularly important among eukaryotic organelles because it is the location of a cell's DNA. Two other critical organelles are mitochondria and chloroplasts, which play important roles in energy conversion and are thought to have their evolutionary origins as simple single-celled organisms.
Have a great day! :)
Answer:
a sense organ
Explanation:
this is because sense organs are part of nervous system
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The nurse identifies from a client's prenatal record that she has a documented gynecoid pelvis. Upon the client entering the labor and delivery department, the nurse is aware that THIS PELVIS IS BEST SUITED FOR LABOR AND NORMAL DELIVERY. THE NURSE SHOULD PREPARE FOR A NORMAL LABOR WITHOUT TAKING ANY EXTRA CARE.
Gynecoid pelvis is a typical female pelvis shape which is favorable for normal birth of a baby.
