1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
6

Where do babies come from

Biology
2 answers:
masya89 [10]3 years ago
5 0
When two people meet and have a certain type of intercourse and after a nine month time a child is made in the womans womb and is delivered when fully produced. duhhhhh
madreJ [45]3 years ago
5 0

Answer:

During a sexual inter course which involves a men a women the men releases sperm from the penis head which travels through the woman vagina making it's way up to the egg which is located in the stomach the sperm will then shoot into the egg and stay there after sometime the baby will start to form which usually takes up to nine months and when the nine months is complete the baby is born

Explanation:

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
An organism that can produce its own energy using sunlight is called a(n)
Natalija [7]
It is called an autotroph.
6 0
4 years ago
What is shown in the figure below?
alexdok [17]

Answer:

Answer is C.

Explanation:

I hope it's helpful!

7 0
3 years ago
Read 2 more answers
Which of these is correct? A) Oxygen + Sugar → Energy + Carbon dioxide + Water B) Carbon + Sugar → Energy + Carbon dioxide + Wat
AnnZ [28]
The answer of this question is C 
5 0
4 years ago
Which following is dead structure in cell ​
steposvetlana [31]

Answer:cell wall

Explanation:The cell wall in plant cell is made of cellulose and functions to provide rigidity to the cell. Cell wall has no living function

5 0
3 years ago
Other questions:
  • What is this thing ???
    12·2 answers
  • The majority of americans with diabetes have ____________ , formerly called ____________ .
    9·1 answer
  • How is scientific theory developed
    12·1 answer
  • Muscular strength is assessed by measuring what?
    5·1 answer
  • Which statement describe a pattern shown in the data?
    8·2 answers
  • 10. Overall, a building up reaction.<br> (5 Points)<br> Photosynthesis<br> Respiration<br> Both
    10·1 answer
  • compare and contrast the traits and growth patterns of oppertunistic versus equilibrium populations. provide examples
    8·1 answer
  • 11/13/2020
    8·1 answer
  • What happens to the gravitational force exerted by one object on another when the mass of the objects is doubled?
    6·1 answer
  • Why do we compare the dermal tissue of plants to human skin? Explain your answer.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!