1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
4 years ago
11

What happens during the Krebs cycle

Biology
1 answer:
yan [13]4 years ago
7 0
During the Krebs cycle, pyruvic acid is broken down into carbon dioxide in a <span>series of energy-extracting reactions.
Hope this answers your question.</span>
You might be interested in
Two trees have the same girth but different heights. The volume of the shorter tree is estimated to be 142 cubic feet.
finlep [7]

Answer:

Explanation:fsshj

3 0
3 years ago
There are two species of sparrows that appear very similar to each other. A scientist tried tomate them. He observed that in spi
Flauer [41]
So the most scientist is trying to mate to birds together. This will mean that he s probably just putting them both in the same cage. Since they're not going anywhere, it can't be migration. Most likely, they're not isolated from one another by location, unless there in a crazy huge, national park size cage. By elimination. the answer would be "<span>C.Reproductive isolation"</span>
8 0
4 years ago
Witch of the following accord along coasts during the day
mina [271]

The following one that accords along coasts during the day is sea breezes. These happen when the cold air from the ocean is gushed to the land around and and because water is slow to absorb heat, it causes breezes we call sea breezes.


Answer: Sea breezes

Shoutout to: @Taskmasters

Note: Witch how you spelled it means a witch that works with magic. The "which" you were trying to use is spelled which. Also next time it helps if you put out the options too. I saw this was your first question so it's all right. I hope this was helpful to you! (before you use your points to ask a question, search brainly or the internet for it and you might find it and you don't have to use your points ; ) )



overcome; live



3 0
4 years ago
Jesus gave his disciples a miraculous catch of fish this many times .
pogonyaev

Answer:

3

Explanation:

this is how many times he have his disciples a miraculous catch of fish

7 0
2 years ago
Read 2 more answers
If a roller coaster train has a potential energy of 1,500 J and a kinetic energy of 500 J as it starts to travel downhill, its t
Gala2k [10]

Answer:

4kt

Explanation:

aint nobdy safe

7 0
4 years ago
Read 2 more answers
Other questions:
  • As a result of Alfred Hershey and Martha Chase’s work, the scientific community finally agreed that ______________________. A-ba
    14·2 answers
  • If element x has 69 protons, how many electrons does it have? electrons
    7·1 answer
  • Please select the word from the list that best fits the definition Is the same size as Earth, has no moons, and has a thick atmo
    5·2 answers
  • Watson, Detra, Fox, Ewing, Gearhart, and DeMotts (1996) administered two self-report alcoholism measures to 118 volunteers recru
    10·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Does anyone know this ?? help!! please!!
    9·1 answer
  • What would most likely happen to the chipmunk population in 2014 if the population went up to 22 million in 2013?
    8·2 answers
  • Si la filosofia es un saber acerca de las cosas desde un punto de vista universal, entonces dificilmente sea ciencia
    8·1 answer
  • Can plz hurry i have a 1 hr
    14·1 answer
  • Can someone help me with this bio question and explain it to me please. im very confused
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!