Answer:
Water has adhesive force between it's molecules and the penny s molecules
Explanation:
Hope it helps
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Plants, Animals, Protists, fungi, archaebacteria, eubacteria
Ans.
Lac (lactose) operon in a type of bacterial operon, which shows a cluster of genes that are regulated by a single promoter. It is composed of an operator, promoter, a terminator, and three structural genes (lacA, lacY, and lacZ), which are responsible for the transport and breakdown of lactose.
The lac operon is an inducible operon as it gets activated in the presence of lactose and expressed its functional genes in the form of proteins (or enzymes) for lactose metabolism.
Thus, the correct answer to be fill in first blank is 'inducible' and in second blank is 'lactose.'
Answer: In diagram B, the magma here is observed to be within the crust and could not come out to the surface. This signifies that the hot, rising magma, suddenly cooled down forming a huge block of mass which is considered to be an intrusive igneous body. It can be a batholith, lacolith or a pluton. This type of body is formed due to the cooling and the consolidation of hot magma.
