During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
The type of vesicular transport involved in the exporting of protein-based hormones, such as insulin, into the bloodstream is regulated exocytosis.
Explanation:
In general terms, exocytosis is a type of active transport that allows intracellular substances are released to the extracellular space, through of vesicles that fuse with the plasma membrane, which allow the exit of substances from inside the cell.
Regulated exocytosis is the specific vesicular transport for the secretion of substances, such as hormones. For this type of transport to exist, the presence of an extracellular signal is required, which will activate the fusion of the vesicles.
In the case of insulin, the external signal originates with the increase in blood glucose levels, a signal that penetrates the intracellular space and generates an increase in insulin production in the islets of Langerhans (pancreas).
Before insulin secretion occurs, the cell must be depolarized, allowing calcium to enter, which promotes transport by regulated exocytosis of insulin to the extracellular space.
Learn more:
brainly.com/question/1109181
Answer:
I think it is the first one
There is more solute in the roots
Can you put the terms as well, please
Answer:
The correct answer is None of these choices are correct.
Explanation:
Crossing over doesn't occur only between heterozygous genes, it also doesn't happen only in some chromosomes and it never reduces de variation, otherwise, the crossing over is one of the main causes of variation among species.
