1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
4 years ago
5

How does sexual life cycle increase the genetic variation in a species

Biology
1 answer:
SCORPION-xisa [38]4 years ago
3 0

Answer:

The behavior of chromosomes during meiosis and fertilization is responsible for most of the variation that arises in each generation. Three mechanisms contribute to genetic variation arising from sexual reproduction: independent assortment of chromosomes, crossing over, and random fertilization.

You might be interested in
The theme and subject of a story are related in what way?
Anvisha [2.4K]
The theme is the writer's view of or comment about the subject. The answer to your question is D. I hope this is the answer that you are looking for and it comes to your help.
7 0
3 years ago
Read 2 more answers
QUESTION 1
Arturiano [62]
Im gonna answer the ones i stufied in grade5 and back soo question 2 a food web question 4 they break down dead and decaying organic material question7 omnivores
3 0
3 years ago
Which statement is true of the zero tolerance policy?
kodGreya [7K]

Answer:

d

Explanation:

8 0
3 years ago
The substance that are present before any chemical reaction are called
wariber [46]
Reactants. Reactants are the substances that are needed for a chemical reaction to occur. Without reactants there are no products.
8 0
3 years ago
Read 2 more answers
What is the main reason that species are being lost to extinction?
Blizzard [7]
The main reason for the species extinction is for the ecological changes.
4 0
3 years ago
Other questions:
  • Where is CO2 reduced during the calvin cycle reactions
    7·1 answer
  • Energy is transferred between the atmosphere and hydrosphere by which two processes?
    11·2 answers
  • 4. Your ability to steer a vehicle depends partly upon the condition of the vehicle's suspension.
    7·2 answers
  • What substance makes up 75 to 90% of every cell in the human body?
    13·2 answers
  • A prediction of the theory of Plate Tectonics is that new volcanoes can form at the boundary of two plates as magma seeps betwee
    13·2 answers
  • The theory of ________ states that organisms that are better suited for their environment will survive and reproduce, while thos
    11·2 answers
  • True or False. An action potential can exist when both sides of the cell membrane have the same charge.
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • True or false are sun is now the main sequence of its life cycle
    8·1 answer
  • How does chlorophyll aid in the process of photosynthesis? *
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!