Answer:
Charles Darwin and Alfred Russel Wallace
Answer:
the overlapping decreases between the thin and thick filaments.
Explanation:
When w extend our hand or arm to the full and try to lift any heavy object, we are unable to lift the object inspite of applying all our force. We struggle hard to lift the object with our fully extended arm because when we extend our arm fully it decreases the overlapping of our thin and the thick filaments of our muscles which makes it difficult to lift. In other words, the resting length of our arm is the optimal length to generate force.
Answer:
Contagious is a method in which a bloodborne pathogen may be transmitted
Explanation:
Contagious are contacted as a result of transmission through blood contact, serum, sweat among others where diseases are said to be infectious
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
