1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
14

CU.

Biology
1 answer:
Grace [21]3 years ago
3 0

Answer:

The answer is bees.

Hope this helps

You might be interested in
Basalt is a gray or black igneous rock. Pilar uses an absolute dating method to study a sample of basalt. What will the method h
pentagon [3]
Hi how does this work how do I answer
5 0
3 years ago
How did Kepler describe the planets’ orbits? The planets’ orbits are circular. The planets’ orbits are elliptical. The planets a
horsena [70]

Answer:

Kepler described the orbits of the planets as elliptical. They were thought to be circular.

Explanation:

7 0
3 years ago
Read 2 more answers
Biological organization extends beyond the organism to include which of the following?
seropon [69]
The answer is A. populations, communities, and ecosystems
5 0
3 years ago
Read 2 more answers
Can someone help please
Liono4ka [1.6K]

Answer:

the mutation they are talking about deals with genes/dna

Explanation:

they show one person (j) who does not have the mutation and therefore does not have the syndrome h

then they show person (k) who has a mutation and therefore had syndrome h

look carefully at the letters on the lines. they represent the DNA in people and correlate to each other

(I hope this helped a little bit and I may he completely wrong but I think I'm mostly right)

7 0
3 years ago
Know how to use a food web to determine the number of food chains an organism is a part of.
Gennadij [26K]

Answer: ok

Explanation:

I know how to use the food web to determine......

3 0
3 years ago
Other questions:
  • Can someone please help find the definitions to my biology vocabulary!!
    6·1 answer
  • Does salt move inside or outside
    6·1 answer
  • The synthesis of the enzyme lipase would be classified as anabolic because A) the resulting enzyme can catalyze the breakdown of
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If a system requires 150 J of input work and produces 123 J of output work, what's its efficiency?
    9·1 answer
  • 5) The chemical process for respiration A) releases ADP. B) releases energy. C) releases oxygen. D) releases glucose.
    15·2 answers
  • Which statement best describes the role of phosphorus in the body?
    7·1 answer
  • Which kind of energy propels a sailboat? A) chemical energy , B) electrical energy, C) mechanical energy, D) thermal energy
    12·1 answer
  • Lol pls help i really need help
    7·1 answer
  • What is a prokaryote and when did prokaryotes arise
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!